Creative Biolabs

Human apolipoprotein E (APOE), transcript variant 4 (NM_001302690) ORF clone, Untagged

[CAT#: NEP-0421-R0259]

Human Apolipoprotein E (APOE) (NM_001302690) ORF Clone, Untagged

Target:
Apo E
Gene/Insert name:
APOE
Type:
Expression Vector/ Viral Particle

Datasheet MSDS Request COA

Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number

Bulk Quote
Description
This is a human APOE untagged clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
APOE
Species
Human
Insert Size (bp)
954 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6 series
Vector Type
CMV
Virus Type
CMV
ORF Nucleotide Sequence
ATGAAGGTTCTGTGGGCTGCGTTGCTGGTCACATTCCTGGCAGGATGCCAGGCCAAGGTGGAGCAAGCGGTGGAGACAGAGCCGGAGCCCGAGCTGCGCCAGCAGACCGAGTGGCAGAGCGGCCAGCGCTGGGAACTGGCACTGGGTCGCTTTTGGGATTACCTGCGCTGGGTGCAGACACTGTCTGAGCAGGTGCAGGAGGAGCTGCTCAGCTCCCAGGTCACCCAGGAACTGAGGGCGCTGATGGACGAGACCATGAAGGAGTTGAAGGCCTACAAATCGGAACTGGAGGAACAACTGACCCCGGTGGCGGAGGAGACGCGGGCACGGCTGTCCAAGGAGCTGCAGGCGGCGCAGGCCCGGCTGGGCGCGGACATGGAGGACGTGTGCGGCCGCCTGGTGCAGTACCGCGGCGAGGTGCAGGCCATGCTCGGCCAGAGCACCGAGGAGCTGCGGGTGCGCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATGACCTGCAGAAGCGCCTGGCAGTGTACCAGGCCGGGGCCCGCGAGGGCGCCGAGCGCGGCCTCAGCGCCATCCGCGAGCGCCTGGGGCCCCTGGTGGAACAGGGCCGCGTGCGGGCCGCCACTGTGGGCTCCCTGGCCGGCCAGCCGCTACAGGAGCGGGCCCAGGCCTGGGGCGAGCGGCTGCGCGCGCGGATGGAGGAGATGGGCAGCCGGACCCGCGACCGCCTGGACGAGGTGAAGGAGCAGGTGGCGGAGGTGCGCGCCAAGCTGGAGGAGCAGGCCCAGCAGATACGCCTGCAGGCCGAGGCCTTCCAGGCCCGCCTCAAGAGCTGGTTCGAGCCCCTGGTGGAAGACATGCAGCGCCAGTGGGCCGGGCTGGTGGAGAAGGTGCAGGCTGCCGTGGGCACCAGCGCCGCCCCTGTGCCCAGCGACAATCACTGA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmitter; Growth and Development
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C
Research Use Only
For research use only
Target
Apo E
Official Name
APOE
Full Name
Apolipoprotein E
Alternative Names
APOE; AD2; APO-E; LDLCQ5; LPG; apolipoprotein E; ApoE4
Gene ID
348(Human)
Uniprot ID
P02649(Human)
Kits
Neural Genes
Neural Cell Lines
Neural Antibodies
Neural Proteins & Peptides
For Research Use Only. Not For Clinical Use.
Send Inquiry Send Inquiry
Inquiry Basket
compare

Go to compare