Human crystallin, alpha B (CRYAB) (NM_001885) clone, Untagged
[CAT#: NEP-0621-R0193]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- Alpha B Crystallin
- Gene/Insert name:
- CRYAB
- Type:
- Human Untagged Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human CRYAB untagged clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
CRYAB
Species
Human
Insert Size (bp)
528 bp
Tag
Tag Free
Type
Human Untagged Clone
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
Cell Selection
ATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTCTTTCCTTTCCACTCCCCCAGCCGCCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGATCTTTTCCCGACGTCTACTTCCCTGAGTCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGTTTGACACTGGACTCTCAGAGATGCGCCTGGAGAAGGACAGGTTCTCTGTCAACCTGGATGTGAAGCACTTCTCCCCAGAGGAACTCAAAGTTAAGGTGTTGGGAGATGTGATTGAGGTGCATGGAAAACATGAAGAGCGCCAGGATGAACATGGTTTCATCTCCAGGGAGTTCCACAGGAAATACCGGATCCCAGCTGATGTAGACCCTCTCACCATTACTTCATCCCTGTCATCTGATGGGGTCCTCACTGTGAATGGACCAAGGAAACAGGTCTCTGGCCCTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCACCGCAGCCCCCAAGAAATAG
Protein Sequence
NotI-NotI
Application Notes
Ion-exchange column purified
Purification
Neural Diseases
Research Areas
Growth and Development
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
Cells
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
- Rat Microglia Cell Line HAPI, Immortalized (Cat#: NCL2110P015)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Rat Immortalized Retinal Muller Cell Line rMC-1 (Cat#: NCL-2106-S93)
- Mouse Glioma Cell Line GL261-GFP (Cat#: NCL-2108P04)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Rat Glioma Cell Line C6 (Cat#: NCL2110P346)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Mouse Microglia from C57BL/6 (Cat#: NCL-21P6-082)
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
Kits
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
Tracers
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
Gene Related Products
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
Cell Assay Reagents
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
