Human cyclin-dependent kinase 5, regulatory subunit 1 (p35) (CDK5R1) (NM_003885) ORF clone, Untagged
[CAT#: NEP-0421-R0323]
Human p35 (CDK5R1) (NM_003885) ORF Clone, Untagged
- Target:
- p35
- Gene/Insert name:
- CDK5R1
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human CDK5R1 untagged clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
CDK5R1
Species
Human
Insert Size (bp)
4130 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Ampicillin (100 ug/mL)
ORF Nucleotide Sequence
ATGGGCACGGTGCTGTCCCTGTCTCCCAGCTACCGGAAGGCCACGCTGTTTGAGGATGGCGCGGCCACCGTGGGCCACTATACGGCCGTACAGAACAGCAAGAACGCCAAGGACAAGAACCTGAAGCGCCACTCCATCATCTCCGTGCTGCCTTGGAAGAGAATCGTGGCCGTGTCGGCCAAGAAGAAGAACTCCAAGAAGGTGCAGCCCAACAGCAGCTACCAGAACAACATCACGCACCTCAACAATGAGAACCTGAAGAAGTCGCTGTCGTGCGCCAACCTGTCCACATTCGCCCAGCCCCCACCGGCCCAGCCGCCTGCACCCCCGGCCAGCCAGCTCTCGGGTTCCCAGACCGGGGGCTCCTCCTCAGTCAAGAAAGCCCCTCACCCTGCCGTCACCTCCGCAGGGACGCCCAAACGGGTCATCGTCCAGGCGTCCACCAGTGAGCTGCTTCGCTGCCTGGGTGAGTTTCTCTGCCGCCGGTGCTACCGCCTGAAGCACCTGTCCCCCACGGACCCCGTGCTCTGGCTGCGCAGCGTGGACCGCTCGCTGCTTCTGCAGGGCTGGCAGGACCAGGGCTTCATCACGCCGGCCAACGTGGTCTTCCTCTACATGCTCTGCAGGGATGTTATCTCCTCCGAGGTGGGCTCGGATCACGAGCTCCAGGCCGTCCTGCTGACATGCCTGTACCTCTCCTACTCCTACATGGGCAACGAGATCTCCTACCCGCTCAAGCCCTTCCTGGTGGAGAGCTGCAAGGAGGCCTTTTGGGACCGTTGCCTCTCTGTCATCAACCTCATGAGCTCAAAGATGCTGCAGATAAATGCCGACCCACACTACTTCACACAGGTCTTCTCCGACCTGAAGAACGAGAGCGGCCAGGAGGACAAGAAGCGGCTCCTCCTAGGCCTGGATCGGTGA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Cell; Neuron
Relevant Diseases
Neurodegenerative Disease; Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C
Research Use Only
For research use only
Target Details
Target
p35
Official Name
CDK5R1
Full Name
Cyclin-dependent kinase 5 activator 1
Alternative Names
CDK5R1; CDK5P35; CDK5R; NCK5A; p23; p25; p35; p35nck5a; cyclin-dependent kinase 5; regulatory subunit 1 (p35); cyclin dependent kinase 5 regulatory subunit 1
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- Mouse Anti-Human α-Synuclein Phospho (Tyr39) (CBP3706) (Cat#: NAB201250LS)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Anti-TREM2 BBB Shuttle Antibody(NRZP-1022-ZP4114) (Cat#: NRZP-1022-ZP4114)
Cells
- iNeu™ Human Schwann Cell (Cat#: NCL-2103-P63)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
- Green Fluorescent Tau SH-SY5Y cell Line (Cat#: NCL2110P219)
- Rat Retinal Muller Cell Line, Immortalized (Cat#: NCL-21P6-192)
- Human Brain Vascular Pericytes (Cat#: NCL-21P6-015)
- Immortalized Human Cerebral Microvascular Endothelial Cells (Cat#: NCL-2108-P020)
- Mouse Midbrain Dopaminergic Neuron Cell MN9D (Cat#: NCL2110P059)
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
Tracers
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
Gene Related Products
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
Biospecimens
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
