Human mesenchyme homeobox 2 (MEOX2) transcript variant (NM_005924) ORF clone, Untagged
[CAT#: NEP-0521-R0221]
Human Homeobox Protein MOX-2 (NM_005924) ORF clone, Untagged
- Target:
- MEOX 2
- Gene/Insert name:
- MEOX2
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human MEOX2 untagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
MEOX2
Species
Human
Insert Size (bp)
2340 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Ampicillin (100 ug/mL)
ORF Nucleotide Sequence
ATGGAACACCCGCTCTTTGGCTGCCTGCGCAGCCCTCACGCCACGGCGCAAGGCTTGCACCCGTTCTCCCAATCCTCTCTCGCCCTCCATGGAAGATCTGACCATATGTCTTACCCCGAGCTCTCTACTTCTTCCTCATCTTGCATAATCGCGGGATACCCCAACGAAGAGGGCATGTTTGCCAGCCAGCATCACAGGGGGCACCACCACCACCACCACCACCACCACCATCACCACCATCAGCAGCAGCAGCACCAGGCTCTGCAAACCAACTGGCACCTCCCGCAGATGTCTTCCCCACCGAGTGCGGCTCGGCACAGCCTCTGCCTCCAGCCCGACTCTGGAGGGCCCCCAGAGTTGGGGAGCAGCCCGCCCGTCCTGTGCTCCAACTCTTCCAGCTTGGGCTCCAGCACCCCGACTGGGGCCGCGTGCGCGCCGGGGGACTACGGCCGCCAGGCACTGTCACCTGCGGAGGCGGAGAAGCGAAGCGGCGGCAAGAGGAAAAGCGACAGCTCAGACTCCCAGGAAGGAAATTACAAGTCAGAAGTCAACAGCAAACCCAGGAAAGAAAGGACAGCATTTACCAAAGAGCAAATCAGAGAACTTGAAGCAGAATTTGCCCATCATAATTATCTCACCAGACTGAGGCGATACGAGATAGCAGTGAATCTGGATCTCACTGAAAGACAGGTGAAAGTCTGGTTCCAAAACAGGCGGATGAAGTGGAAGAGGGTAAAGGGTGGACAGCAAGGAGCTGCGGCTCGGGAAAAGGAACTGGTGAATGTGAAAAAGGGAACACTTCTCCCATCAGAGCTGTCGGGAATTGGTGCAGCCACCCTCCAGCAAACAGGGGACTCTATAGCAAATGAAGACAGTCACGACAGTGACCACAGCTCAGAGCATGCGCACTTATGA
Restriction Sites
NotI-NotI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Growth and Development
Relevant Diseases
Alzheimer's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Anti-Alpha Synuclein BBB Shuttle Antibody(NRZP-1022-ZP4050) (Cat#: NRZP-1022-ZP4050)
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
Cells
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Mouse Microglia from C57BL/6 (Cat#: NCL-21P6-082)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- iNeu™ Human Schwann Cell (Cat#: NCL-2103-P63)
- Mouse Microglia N9 (Cat#: NCL2110P073)
Kits
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
Tracers
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
Gene Related Products
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
Biospecimens
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
