Human myelin basic protein (MBP) transcript variant 2 (NM_002385) ORF clone, Untagged
[CAT#: NEP-0521-R0408]
Human Myelin Basic Protein (MBP) (NM_002385) ORF clone, Untagged
- Target:
- Myelin Basic Protein
- Gene/Insert name:
- MBP
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human MBP untagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
MBP
Species
Human
Insert Size (bp)
561 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
ORF Nucleotide Sequence
ATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGTACCCTGGCTAAAGCCGGGCCGGAGCCCTCTGCCCTCTCATGCCCGCAGCCAGCCTGGGCTGTGCAACATGTACAAGGACTCACACCACCCGGCAAGAACTGCTCACTACGGCTCCCTGCCCCAGAAGTCACACGGCCGGACCCAAGATGAAAACCCCGTAGTCCACTTCTTCAAGAACATTGTGACGCCTCGCACACCACCCCCGTCGCAGGGAAAGGGGGCCGAAGGCCAGAGACCAGGATTTGGCTACGGAGGCAGAGCGTCCGACTATAAATCGGCTCACAAGGGATTCAAGGGAGTCGATGCCCAGGGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGAGATAGTCGCTCTGGATCACCCATGGCTAGACGC
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Metabolism
Relevant Diseases
Parkinson's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
Cells
- Mouse Midbrain Dopaminergic Neuron Cell MN9D (Cat#: NCL2110P059)
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- iNeu™ Human Midbrain Dopaminergic Neurons (Cat#: NCL-21P6-003)
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- Rat Microglia Cell Line HAPI, Immortalized (Cat#: NCL2110P015)
- Human Hippocampal Neuron Cells HPPNCs (Cat#: NCL2110P106)
- Rat Muller Cell (Cat#: NCL2110P040)
- C57 Brain Cortex Neurons [Mouse] (Cat#: NCC20-9PZ48)
Kits
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
Tracers
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
Gene Related Products
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
Cell Assay Reagents
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
