Human myelin basic protein (MBP) transcript variant 8 (NM_001025100) ORF clone, Untagged
[CAT#: NEP-0521-R0409]
Human Myelin Basic Protein (MBP) (NM_001025100) ORF clone, Untagged
- Target:
- Myelin Basic Protein
- Gene/Insert name:
- MBP
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human MBP untagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
MBP
Species
Human
Insert Size (bp)
594 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
ATGGGAAACCACGCAGGCAAACGAGAATTAAATGCCGAGAAGGCCAGTACGAATAGTGAAACTAACAGAGGAGAATCTGAAAAAAAGAGAAACCTGGGTGAACTTTCACGGACAACCTCAGAGGACAACGAAGTGTTCGGAGAGGCAGATGCGAACCAGAACAATGGGACCTCCTCTCAGGACACAGCGGTGACTGACTCCAAGCGCACAGCGGACCCGAAGAATGCCTGGCAGGATGCCCACCCAGCTGACCCAGGGAGCCGCCCCCACTTGATCCGCCTCTTTTCCCGAGATGCCCCGGGGAGGGAGGACAACACCTTCAAAGACAGGCCCTCTGAGTCCGACGAGCTCCAGACCATCCAAGAAGACAGTGCAGCCACCTCCGAGAGCCTGGATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGTGAGCTCTGAGGAGTAG
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Metabolism
Relevant Diseases
Parkinson's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
Lenti of Mouse myelin basic protein (Mbp) transcript variant 2 (NM_001025254) ORF clone, mGFP Tagged
Lenti of Mouse myelin basic protein (Mbp) transcript variant 1 (NM_001025251) ORF clone, mGFP Tagged
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1684) (Cat#: NRP-0422-P1684)
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
Cells
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- Rat Microglia Cell Line HAPI, Immortalized (Cat#: NCL2110P015)
- Immortalized Human Cerebral Microvascular Endothelial Cells (Cat#: NCL-2108-P020)
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
Kits
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
Tracers
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
Gene Related Products
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
Biospecimens
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
Cell Assay Reagents
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
