Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, Untagged
[CAT#: NEP-0521-R0747]
Human Superoxide Dismutase 1 (NM_000454) ORF clone, Untagged
- Target:
- SOD1
- Gene/Insert name:
- SOD1
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human SOD1 untagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
SOD1
Species
Human
Insert Size (bp)
940 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Ampicillin (100 ug/mL)
ORF Nucleotide Sequence
ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAATTTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA
Restriction Sites
NotI-NotI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmission; Cell Adhension Proteins
Relevant Diseases
Amyotrophic Lateral Sclerosis
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Kits
Neural Genes
Neural Antibodies
Neural Cell Lines
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Alpha Synuclein BBB Shuttle Antibody(NRZP-1022-ZP4050) (Cat#: NRZP-1022-ZP4050)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
Cells
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- Human Glioblastoma Cell Line SF126 (Cat#: NCL-2108P35)
- iNeu™ Human Schwann Cell (Cat#: NCL-2103-P63)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Human Hippocampal Neuron Cells HPPNCs (Cat#: NCL2110P106)
- Green Fluorescent Alpha-synuclein SH-SY5Y Cell Line (Cat#: NCL2110P209)
- C57 Brain Cortex Neurons [Mouse] (Cat#: NCC20-9PZ48)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Rat Immortalized Retinal Muller Cell Line rMC-1 (Cat#: NCL-2106-S93)
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
Tracers
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
Gene Related Products
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
Biospecimens
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
