Lenti of Human myelin basic protein (MBP) transcript variant 3 (NM_001025090) ORF clone, mGFP Tagged
[CAT#: NEP-0521-R0392]
Human Myelin Basic Protein (MBP) (NM_001025090) ORF clone, mGFP Tagged
- Target:
- Myelin Basic Protein
- Gene/Insert name:
- MBP
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human MBP mGFP tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
MBP
Species
Human
Insert Size (bp)
513 bp
Tag
mGFP
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGACTCACACCACCCGGCAAGAACTGCTCACTACGGCTCCCTGCCCCAGAAGTCACACGGCCGGACCCAAGATGAAAACCCCGTAGTCCACTTCTTCAAGAACATTGTGACGCCTCGCACACCACCCCCGTCGCAGGGAAAGGGGAGAGGACTGTCCCTGAGCAGATTTAGCTGGGGGGCCGAAGGCCAGAGACCAGGATTTGGCTACGGAGGCAGAGCGTCCGACTATAAATCGGCTCACAAGGGATTCAAGGGAGTCGATGCCCAGGGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGAGATAGTCGCTCTGGATCACCCATGGCTAGACGCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MASQKRPSQRHGSKYLATASTMDHARHGFLPRHRDTGILDSIGRFFGGDRGAPKRGSGKDSHHPARTAHYGSLPQKSHGRTQDENPVVHFFKNIVTPRTPPPSQGKGRGLSLSRFSWGAEGQRPGFGYGGRASDYKSAHKGFKGVDAQGTLSKIFKLGGRDSRSGSPMARRTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Metabolism
Relevant Diseases
Parkinson's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1684) (Cat#: NRP-0422-P1684)
- NeuroMab™ Anti-CD32b Antibody(NRP-0422-P1803) (Cat#: NRP-0422-P1803)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
Cells
- iNeu™ Human Midbrain Dopaminergic Neurons (Cat#: NCL-21P6-003)
- Mouse Microglia N9 (Cat#: NCL2110P073)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Rat Retinal Muller Cell Line, Immortalized (Cat#: NCL-21P6-192)
- Sf295 Human Glioblastoma Cells (Cat#: NCL-2108P180)
- Human Glioblastoma Cell Line SF126 (Cat#: NCL-2108P35)
- Mouse Microglia from C57BL/6 (Cat#: NCL-21P6-082)
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
Tracers
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
Gene Related Products
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
Cell Assay Reagents
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
