Lenti of Mouse crystallin, alpha B (Cryab) transcript variant (NM_009964) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0621-R0201]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- Alpha B Crystallin
- Gene/Insert name:
- CRYAB
- Type:
- Mouse Tagged ORF Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse CRYAB Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
CRYAB
Species
Mouse
Insert Size (bp)
528 bp
Tag
Myc-DDK
Type
Mouse Tagged ORF Clone
Vector
pLenti
E. coli Selection
Puromycin
Cell Selection
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCTTCCCCTTCCACTCCCCAAGCCGCCTCTTCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTTCTCAACAGCCACTTCCCTGAGCCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATTGACACCGGACTCTCAGAGATGCGTTTGGAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCTCTCCGGAGGAACTCAAAGTCAAGGTTCTGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCAGGACGAACATGGCTTCATCTCCAGGGAGTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTCACCATCACTTCATCCCTGTCATCTGATGGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCCCTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
ORF Nucleotide Sequence
MDIAIHHPWIRRPFFPFHSPSRLFDQFFGEHLLESDLFSTATSLSPFYLRPPSFLRAPSWIDTGLSEMRLEKDRFSVNLDVKHFSPEELKVKVLGDVIEVHGKHEERQDEHGFISREFHRKYRIPADVDPLTITSSLSSDGVLTVNGPRKQVSGPERTIPITREEKPAVAAAPKKTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Neural Diseases
Research Areas
Growth and Development
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2275) (Cat#: NRP-0422-P2275)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
Cells
- Rat Retinal Muller Cell Line, Immortalized (Cat#: NCL-21P6-192)
- Human Glioblastoma Cell Line SF126 (Cat#: NCL-2108P35)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Human Brain Vascular Pericytes (Cat#: NCL-21P6-015)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- iNeu™ Human Midbrain Dopaminergic Neurons (Cat#: NCL-21P6-003)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Mouse Hippocampal Neuron Cell HT22 (Cat#: NCL2110P001)
- Green Fluorescent Alpha-synuclein SH-SY5Y Cell Line (Cat#: NCL2110P209)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
Kits
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
Tracers
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
Gene Related Products
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
Biospecimens
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
Cell Assay Reagents
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
