Lenti of Rat crystallin, alpha B (Cryab) transcript variant (NM_012935) ORF clone, mGFP Tagged
[CAT#: NEP-0621-R0198]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- Alpha B Crystallin
- Gene/Insert name:
- CRYAB
- Type:
- Rat Tagged ORF Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a rat CRYAB mGFP tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
CRYAB
Species
Rat
Insert Size (bp)
525 bp
Tag
mGFP
Type
Rat Tagged ORF Clone
Vector
pLenti
Cell Selection
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGACATAGCCATCCACCACCCCTGGATCCGGCGTCCCTTCTTTCCTTTCCACTCCCCAAGCCGCCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTTCTCTACAGCCACTTCCCTGAGCCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCTAGCTGGATTGACACTGGGCTCTCAGAGATGCGTATGGAGAAGGACAGGTTCTCTGTGAACCTGGACGTGAAGCACTTCTCTCCAGAGGAACTCAAAGTCAAGGTTCTGGGAGACGTGATTGAGGTGCACGGCAAGCACGAAGAGCGCCAGGACGAACATGGCTTCATCTCCAGGGAGTTCCACAGGAAGTACCGGATCCCAGCCGACGTGGATCCTCTCACCATTACTTCTTCCCTGTCATCGGATGGAGTCCTCACTGTGAATGGACCAAGGAAACAGGCCTCTGGCCCTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCACTGCAGCCCCTAAGAAGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
ORF Nucleotide Sequence
MDIAIHHPWIRRPFFPFHSPSRLFDQFFGEHLLESDLFSTATSLSPFYLRPPSFLRAPSWIDTGLSEMRMEKDRFSVNLDVKHFSPEELKVKVLGDVIEVHGKHEERQDEHGFISREFHRKYRIPADVDPLTITSSLSSDGVLTVNGPRKQASGPERTIPITREEKPAVTAAPKKTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Neural Diseases
Research Areas
Growth and Development
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
Cells
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- Human Microglia Cell Line HMC3, Immortalized (Cat#: NCL-2108P38)
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Immortalized Human Cerebral Microvascular Endothelial Cells (Cat#: NCL-2108-P020)
- C57 Brain Cortex Neurons [Mouse] (Cat#: NCC20-9PZ48)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
Kits
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
Tracers
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
Gene Related Products
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
Biospecimens
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
Cell Assay Reagents
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
