Mouse presenilin 1 (cDNA clone MGC:25288 IMAGE:4511140) (BC014744) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0421-R0142]
Mouse Psen1 (BC014744) ORF Clone, Myc-DDK Tagged
- Target:
- Presenilin 1
- Gene/Insert name:
- PSEN1
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse PSEN1 Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
PSEN1
Species
Mouse
Insert Size (bp)
783 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGACAGAGATACCTGCACCTTTGTCCTACTTCCAGAATGCCCAGATGTCTGAGGACAGCCACTCCAGCAGCGCCATCCGGAGCCAGAATGACAGCCAAGAACGGCAGCAGCAGCATGACAGGCAGAGACTTGACAACCCTGAGCCAATATCTAATGGGCGGCCCCAGAGTAACTCAAGACAGGTGGTGGAACAAGATGAGGAGGAAGACGAAGAGCTGACATTGAAATATGGAGCCAAGCATGTCATCATGCTCTTTGTCCCCGTGACCCTCTGCATGGTCGTCGTCGTGGCCACCATCAAATCAGTCAGCTTCTATACCCGGAAGGACGGTCAGCTAATCTACACCCCATTCACAGAAGACACTGAGACTGTAGGCCAAAGAGCCCTGCACTCGATCCTGAATGCGGCCATCATGATCAGTGTCATTGTCATTATGACCATCCTCCTGGTGGTCCTGTATAAATACAGGTGCTACAAGGTCATCCACGCCTGGCTTATTATTTCATCTCTGTTGTTGCTGTTCTTTTTTTCGTTCATTTACTTAGGGGAAGTATTTAAGACCTACAATGTCGCCGTGGACTACGTTACAGTAGCACTCCTAATCTGGAATTTTGGTGTGGTCGGGATGATTGCCATCCACTGGAAAGGCCCCCTTCGACTGCAGCAGGCGTATCTCATTATGATCAGTGCCCTCATGGCCCTGGTATTTATCAAGTACCTCCCCGAATGGACCGCATGGCTCATCTTGGCTGTGATTTCAGTATATGGTAAAGCTCAAGACACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MTEIPAPLSYFQNAQMSEDSHSSSAIRSQNDSQERQQQHDRQRLDNPEPISNGRPQSNSRQVVEQDEEEDEELTLKYGAKHVIMLFVPVTLCMVVVVATIKSVSFYTRKDGQLIYTPFTEDTETVGQRALHSILNAAIMISVIVIMTILLVVLYKYRCYKVIHAWLIISSLLLLFFFSFIYLGEVFKTYNVAVDYVTVALLIWNFGVVGMIAIHWKGPLRLQQAYLIMISALMALVFIKYLPEWTAWLILAVISVYGKAQDTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neuroregeneration; Neural Cell
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
Neural Cell Lines
Kits
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Alpha Synuclein BBB Shuttle Antibody(NRZP-1022-ZP4050) (Cat#: NRZP-1022-ZP4050)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- Mouse Anti-SCN5A Monoclonal Antibody (CBP708) (Cat#: NAB-0720-Z2720)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
- NeuroMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
Cells
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- Immortalized Human Cerebral Microvascular Endothelial Cells (Cat#: NCL-2108-P020)
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
- Mouse Microglia N9 (Cat#: NCL2110P073)
- Rat Immortalized Retinal Muller Cell Line rMC-1 (Cat#: NCL-2106-S93)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
Kits
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
Tracers
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
Gene Related Products
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
Biospecimens
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
Cell Assay Reagents
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
