pAAV-hSyn-Cre-P2A-dTomato
[CAT#: NTA-2012AD-P100]
Can be used to express Cre recombinase and simultaneously the red fluorescent protein dTomato. Can also be used to create adeno-associated virus for delivery of these genes.
- Tracer Type:
- Recombinase
- Applications:
- Recombinase
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
SPECIFIC INQUIRY
inquiryProduct Overview
Description
Cre and dTomato expressions driven by hSyn (physically separate). The purity of these AAV preparations is suitable for injection into animals.
Tracer Type
Recombinase
Serotype
AAV1; AAV5; AAV8; AAV Retro
Virus Type
Adeno-Associated Virus (AAV)
Applications
Recombinase
Sub Type
AAV1; AAV5; AAV8; AAV Retro
Research Areas
Neural Circuit Mapping
Promoter
Syn
Key Components
pAAV-hSyn1-DIO-SSFO-EYFP-P2A-nlsdTomato-WPRE-BGHpA
Expression
Normal Expression
Properites
Titer
≥ 7×10¹² vg/mL
Fluorophore
dTomato
Shipping
Viral particles are shipped frozen on dry ice.
Handling Advice
The lentivirus is generally referred to as BSL-2. AAV is usually considered BSL-1, but may require BSL-101 handling depending on the insert.
Storage
Store at -80°C. Thaw just before use and keep on ice.
Quality Control
Creative Biolabs ensures high-quality viral vectors by optimizing and standardizing production plans and implementing strict quality control (QC). The specific QC analysis performed for each virus batch is different.
Titer: The precise titer of the sample will be reported on the test tube. The potency you see on this page is the guaranteed minimum potency.
Titer: The precise titer of the sample will be reported on the test tube. The potency you see on this page is the guaranteed minimum potency.
Research Use Only
For research use only.
Gene/Insert
Gene/Insert Name
Cre, dTomato
Insert Size (bp)
1839
Growth in Bacteria
Bacterial Resistance(s)
Ampicillin
Growth Temperature
37°C
Growth Strain(s)
NEB Stable
Copy number
Unknown
Cloning Information
Cloning method
Restriction Enzyme
5′ cloning site
HindIII (not destroyed)
3′ cloning site
BamHI (not destroyed)
5′ sequencing primer
AGTCGAGAAACCGGCTAGAG
3′ sequencing primer
CCAGAGGTTGATTATCGATA
References
References
Cre-expressing AAV Plasmids (unpublished)
Publications
Publications (0)
Neural Tracers
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- iNeuMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- Mouse Anti-SCN5A Monoclonal Antibody (CBP708) (Cat#: NAB-0720-Z2720)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- iNeuMab™ Anti-F-Spondin/SPON1 Antibody, Clone 3F4 (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
Cells
- Rat Immortalized Retinal Muller Cell Line rMC-1 (Cat#: NCL-2106-S93)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Human Microglia Cell Line HMC3, Immortalized (Cat#: NCL-2108P38)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
Kits
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
Tracers
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
Gene Related Products
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
Biospecimens
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
Cell Assay Reagents
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
