Human Kv channel interacting protein 1 (KCNIP1), transcript variant 2 (NM_014592) ORF clone, Untagged
[CAT#: NEP-0421-R0370]
Human KCNIP1 (NM_014592) ORF Clone, Untagged
- Target:
- KCNIP1
- Gene/Insert name:
- KCNIP1
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human KCNIP1 untagged clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
KCNIP1
Species
Human
Insert Size (bp)
1730 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Ampicillin (100 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
ATGGGGGCCGTCATGGGCACCTTCTCATCTCTGCAAACCAAACAAAGGCGACCCTCGAAAGATAAGATTGAAGATGAGCTGGAGATGACCATGGTTTGCCATCGGCCCGAGGGACTGGAGCAGCTCGAGGCCCAGACCAACTTCACCAAGAGGGAGCTGCAGGTCCTTTATCGAGGCTTCAAAAATGAGTGCCCCAGTGGTGTGGTCAACGAAGACACATTCAAGCAGATCTATGCTCAGTTTTTCCCTCATGGAGATGCCAGCACGTATGCCCATTACCTCTTCAATGCCTTCGACACCACTCAGACAGGCTCCGTGAAGTTCGAGGACTTTGTAACCGCTCTGTCGATTTTATTGAGAGGAACTGTCCACGAGAAACTAAGGTGGACATTTAATTTGTATGACATCAACAAGGACGGATACATAAACAAAGAGGAGATGATGGACATTGTCAAAGCCATCTATGACATGATGGGGAAATACACATATCCTGTGCTCAAAGAGGACACTCCAAGGCAGCATGTGGACGTCTTCTTCCAGAAAATGGACAAAAATAAAGATGGCATCGTAACTTTAGATGAATTTCTTGAATCATGTCAGGAGGACGACAACATCATGAGGTCTCTCCAGCTGTTTCAAAATGTCATGTAA
Restriction Sites
NotI-NotI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmitter; Neurogenesis
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Anti-Alpha Synuclein BBB Shuttle Antibody(NRZP-1022-ZP4050) (Cat#: NRZP-1022-ZP4050)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
Cells
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- iNeu™ Human Sensory Neurons (Cat#: NCL-2103-P62)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Green Fluorescent Alpha-synuclein SH-SY5Y Cell Line (Cat#: NCL2110P209)
- Green Fluorescent Tau SH-SY5Y cell Line (Cat#: NCL2110P219)
- Rat Muller Cell (Cat#: NCL2110P040)
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- Rat Immortalized Retinal Muller Cell Line rMC-1 (Cat#: NCL-2106-S93)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
Kits
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
Tracers
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
Gene Related Products
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
Cell Assay Reagents
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
