Tel:
Fax:
Email:
Creative Biolabs
Product
Hot Products
Antibodies
Cells
Kits
Tracers
Gene Related Products
Biospecimens
Cell Assay Reagents

Human low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 1 (NM_004631) ORF clone, Untagged

[CAT#: NEP-0421-R0293]

Human ApoER2 (LRP8) (NM_004631) ORF Clone, Untagged

Target:
LRP8
Gene/Insert name:
ApoER2
Type:
Expression Vector/ Viral Particle

Datasheet MSDS Request COA

Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number

Inquiry
Product Overview

Description

This is a human ApoER2 untagged clone expression plasmid, ready for transfecting into mammalian cells.

Gene/Insert Name

ApoER2

Species

Human

Insert Size (bp)

4230 bp

Tag

Tag Free

Type

Expression Vector/ Viral Particle

Vector

pCMV6-XL4

Vector Type

CMV

Virus Type

CMV

E. coli Selection

Ampicillin (100 ug/mL)

ORF Nucleotide Sequence

ATGGGCCTCCCCGAGCCGGGCCCTCTCCGGCTTCTGGCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCAGCTCCAGCATCTTGCGGCGGCAGCGGCTGATCCGCTGCTCGGCGGCCAAGGGCCGGCCAAGGATTGCGAAAAGGACCAATTCCAGTGCCGGAACGAGCGCTGCATCCCCTCTGTGTGGAGATGCGACGAGGACGATGACTGCTTAGACCACAGCGACGAGGACGACTGCCCCAAGAAGACCTGTGCAGACAGTGACTTCACCTGTGACAACGGCCACTGCATCCACGAACGGTGGAAGTGTGACGGCGAGGAGGAGTGTCCTGATGGCTCCGATGAGTCCGAGGCCACTTGCACCAAGCAGGTGTGTCCTGCAGAGAAGCTGAGCTGTGGACCCACCAGCCACAAGTGTGTACCTGCCTCGTGGCGCTGCGACGGGGAGAAGGACTGCGAGGGTGGAGCGGATGAGGCCGGCTGTGCTACCTTGTGCGCCCCGCACGAGTTCCAGTGCGGCAACCGCTCGTGCCTGGCCGCCGTGTTCGTGTGCGACGGCGACGACGACTGTGGTGACGGCAGCGATGAGCGCGGCTGTGCAGACCCGGCCTGCGGGCCCCGCGAGTTCCGCTGCGGCGGCGATGGCGGCGGCGCCTGCATCCCGGAGCGCTGGGTCTGCGACCGCCAGTTTGACTGCGAGGACCGCTCGGACGAGGCAGCCGAGCTCTGCGGCCGCCCGGGCCCCGGGGCCACGTCCGCGCCCGCCGCCTGCGCCACCGCCTCCCAGTTCGCCTGCCGCAGCGGCGAGTGCGTGCACCTGGGCTGGCGCTGCGACGGCGACCGCGACTGCAAAGACAAATCGGACGAGGCCGACTGCCCACTGGGCACCTGCCGTGGGGACGAGTTCCAGTGTGGGGATGGGACATGTGTCCTTGCAATCAAGCACTGCAACCAGGAGCAGGACTGTCCAGATGGGAGTGATGAAGCTGGCTGCCTACAGGGGCTGAACGAGTGTCTGCACAACAATGGCGGCTGCTCACACATCTGCACTGACCTCAAGATTGGCTTTGAATGCACGTGCCCAGCAGGCTTCCAGCTCCTGGACCAGAAGACCTGTGGCGACATTGATGAGTGCAAGGACCCAGATGCCTGCAGCCAGATCTGTGTCAATTACAAGGGCTATTTTAAGTGTGAGTGCTACCCTGGCTACGAGATGGACCTACTGACCAAGAACTGCAAGGCTGCTGCTGGAAAGAGCCCATCCCTAATCTTCACCAACCGGCACGAGGTGCGGAGGATCGACCTGGTGAAGCGGAACTATTCACGCCTCATCCCCATGCTCAAGAATGTCGTGGCACTAGATGTGGAAGTTGCCACCAATCGCATCTACTGGTGTGACCTCTCCTACCGTAAGATCTATAGCGCCTACATGGACAAGGCCAGTGACCCGAAAGAGCAGGAGGTCCTCATTGACGAGCAGTTGCACTCTCCAGAGGGCCTGGCAGTGGACTGGGTCCACAAGCACATCTACTGGACTGACTCGGGCAATAAGACCATCTCAGTGGCCACAGTTGATGGTGGCCGCCGACGCACTCTCTTCAGCCGTAACCTCAGTGAACCCCGGGCCATCGCTGTTGACCCCCTGCGAGGGTTCATGTATTGGTCTGACTGGGGGGACCAGGCCAAGATTGAGAAATCTGGGCTCAACGGTGTGGACCGGCAAACACTGGTGTCAGACAATATTGAATGGCCCAACGGAATCACCCTGGATCTGCTGAGCCAGCGCTTGTACTGGGTAGACTCCAAGCTACACCAACTGTCCAGCATTGACTTCAGTGGAGGCAACAGAAAGACGCTGATCTCCTCCACTGACTTCCTGAGCCACCCTTTTGGGATAGCTGTGTTTGAGGACAAGGTGTTCTGGACAGACCTGGAGAACGAGGCCATTTTCAGTGCAAATCGGCTCAATGGCCTGGAAATCTCCATCCTGGCTGAGAACCTCAACAACCCACATGACATTGTCATCTTCCATGAGCTGAAGCAGCCAAGAGCTCCAGATGCCTGTGAGCTGAGTGTCCAGCCTAATGGAGGCTGTGAATACCTGTGCCTTCCTGCTCCTCAGATCTCCAGCCACTCTCCCAAGTACACATGTGCCTGTCCTGACACAATGTGGCTGGGTCCAGACATGAAGAGGTGCTACCGAGCACCTCAATCTACCTCAACTACGACGTTAGCTTCTACCATGACGAGGACAGTACCTGCCACCACAAGAGCCCCCGGGACCACCGTCCACAGATCCACCTACCAGAACCACAGCACAGAGACACCAAGCCTGACAGCTGCAGTCCCAAGCTCAGTTAGTGTCCCCAGGGCTCCCAGCATCAGCCCGTCTACCCTAAGCCCTGCAACCAGCAACCACTCCCAGCACTATGCAAATGAAGACAGTAAGATGGGCTCAACAGTCACTGCCGCTGTTATCGGGATCATCGTGCCCATAGTGGTGATAGCCCTCCTGTGCATGAGTGGATACCTGATCTGGAGAAACTGGAAGCGGAAGAACACCAAAAGCATGAATTTTGACAACCCAGTCTACAGGAAAACAACAGAAGAAGAAGATGAAGATGAGCTCCATATAGGGAGAACTGCTCAGATTGGCCATGTCTATCCTGCAGCAATCAGCAGCTTTGATCGCCCACTGTGGGCAGAGCCCTGTCTTGGGGAGACCAGAGAACCGGAAGACCCAGCCCCTGCCCTCAAGGAGCTTTTTGTCTTGCCGGGGGAACCAAGGTCACAGCTGCACCAACTCCCGAAGAACCCTCTTTCCGAGCTGCCTGTCGTCAAATCCAAGCGAGTGGCATTAAGCCTTGAAGATGATGGACTACCCTGA

Restriction Sites

SgfI-MluI

Application Notes

The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.

Purification

Ion-exchange column purified

Research Areas

Neuroregeneration; Metabolism

Relevant Diseases

Alzheimer's Disease

Key Components

Transfection-ready dried plasmid DNA
Properties

Soluble In

Sterile water

Appearance

Solid

Shipping

Keep in suitable, closed containers for shipping.

Handling Advice

Avoid breathing vapors, mist or gas.

Storage

Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C

Research Use Only

For research use only
Target Details

Target

LRP8

Official Name

LRP8

Full Name

Apolipoprotein E receptor 2

Alternative Names

LRP8; APOER2; HSZ75190; LRP-8; MCI1; low density lipoprotein receptor-related protein 8; LDL receptor related protein 8

Gene ID

7804(Human); 16975(Mouse); 362558(Rat)

Uniprot ID

Q14114(Human); Q924X6(Mouse)
Publications

Publications (0)

gift-card

Related Products
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Fill out this form for a quote Inquiry Form Send Inquiry
Inquiry Basket
compare

Send inquiry