Lenti of Human PARK2 co-regulated-like (PACRGL), transcript variant 1 (NM_145048) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0621-R0091]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- PACRG
- Gene/Insert name:
- PACRG
- Type:
- Human Tagged ORF Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human PACRG Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
PACRG
Species
Human
Insert Size (bp)
663 bp
Tag
Myc-DDK
Type
Human Tagged ORF Clone
Vector
pLenti
E. coli Selection
Puromycin
Cell Selection
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGCAGAAATCAGAGGGCTCTGGAGGTACACAGTTGAAAAACAGAGCAACAGGTAACTATGATCAAAGGACATCATCAAGCACACAGTTAAAACACAGGAATGCAGTTCAGGGAAGCAAATCCTCATTGTCAACCAGTTCTCCAGAGTCTGCAAGAAAACTTCATCCTAGACCAAGTGATAAACTGAACCCTAAAACAATTAATCCGTTTGGTGAACAGTCACGAGTGCCTTCTGCATTTGCAGCTATTTACTCTAAAGGAGGTATTCCTTGCAGATTGGTACATGGTTCAGTAAAACACAGATTACAGTGGGAATGTCCTCCTGAAAGTCTTTCATTTGATCCACTTCTTATTACTTTAGCTGAGGGTCTGAGAGAGACTAAGCATCCATACACTTTTGTGTCAAAGGAGGGTTTTAGAGAATTACTTTTGGTCAAAGGTGCTCCTGAAAAAGCTATTCCTTTGCTACCTAGACTGATTCCTGTGCTAAAGGCAGCTCTGGTCCATTCGGATGATGAAGTGTTTGAAAGAGGATTGAATGCTCTAGTTCAGCTAAGTGTCGTTGTTGGTCCTTCTCTAAACGACCATCTGAAGCATCTGCTTACAAGCGGGAGCCTTAGCATCATCAAATCTAAAATTCCAACATACTGCTCCATATGCTGTACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
ORF Nucleotide Sequence
MQKSEGSGGTQLKNRATGNYDQRTSSSTQLKHRNAVQGSKSSLSTSSPESARKLHPRPSDKLNPKTINPFGEQSRVPSAFAAIYSKGGIPCRLVHGSVKHRLQWECPPESLSFDPLLITLAEGLRETKHPYTFVSKEGFRELLLVKGAPEKAIPLLPRLIPVLKAALVHSDDEVFERGLNALVQLSVVVGPSLNDHLKHLLTSGSLSIIKSKIPTYCSICCTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Parkinson's Disease; Neurodegenerative Diseases
Research Areas
Neural Signal Transduction
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-TREM2 BBB Shuttle Antibody(NRZP-1022-ZP4114) (Cat#: NRZP-1022-ZP4114)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- iNeuMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
- iNeuMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- NeuroMab™ Anti-CD32b Antibody(NRP-0422-P1803) (Cat#: NRP-0422-P1803)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1684) (Cat#: NRP-0422-P1684)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
Cells
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- iNeu™ Human Sensory Neurons (Cat#: NCL-2103-P62)
- Green Fluorescent Tau SH-SY5Y cell Line (Cat#: NCL2110P219)
- Rat Muller Cell (Cat#: NCL2110P040)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- Mouse Microglia N9 (Cat#: NCL2110P073)
Kits
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
Tracers
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
Gene Related Products
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
Biospecimens
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
Cell Assay Reagents
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
