Mouse ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) (Ube2k) (NM_016786) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0569]
Mouse Ubiquitin-Conjugating Enzyme E2 K (NM_016786) ORF clone, Myc-DDK Tagged
- Target:
- HIP2
- Gene/Insert name:
- HIP2
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse HIP2 Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
HIP2
Species
Mouse
Insert Size (bp)
603 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGCAAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTCCAGACACACCGTATGAAGGTGGAAGATATCAACTAGAGATAAAAATACCAGAAACATATCCATTTAACCCCCCTAAGGTCCGGTTTATCACTAAAATATGGCACCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTGGATATCCTGAAAGATCAATGGGCAGCAGCAATGACTCTGCGCACGGTATTATTGTCATTGCAAGCGCTGTTGGCGGCTGCAGAACCAGATGACCCCCAAGATGCAGTAGTAGCGAATCAGTACAAACAGAATCCTGAAATGTTCAAGCAGACAGCTCGACTTTGGGCACACGTGTACGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTCTGTGCTATGGGTTTTGATAGGAACGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAACTGCTTCTGAGTAACACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MANIAVQRIKREFKEVLKSEETSKNQIKVDLVDENFTELRGEIAGPPDTPYEGGRYQLEIKIPETYPFNPPKVRFITKIWHPNISSVTGAICLDILKDQWAAAMTLRTVLLSLQALLAAAEPDDPQDAVVANQYKQNPEMFKQTARLWAHVYAGAPVSSPEYTKKIENLCAMGFDRNAVIVALSSKSWDVETATELLLSNTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction
Relevant Diseases
Huntington's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2275) (Cat#: NRP-0422-P2275)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- Tau Monoclonal Antibody (AT120, HT7 and BT2 clone) (Cat#: NK-2106-P008)
- NeuroMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- Mouse Anti-SCN5A Monoclonal Antibody (CBP708) (Cat#: NAB-0720-Z2720)
Cells
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Human CMEC/D3 Cell Line, Blood-Brain Barrier Model (Cat#: NCL-2108-P020)
- Mouse Microglia N9 (Cat#: NCL2110P073)
- Sf295 Human Glioblastoma Cells (Cat#: NCL-2108P180)
- Green Fluorescent Alpha-synuclein SH-SY5Y Cell Line (Cat#: NCL2110P209)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
Kits
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-40), Aggregation Kit, TTF Assay (Cat#: NRZP-0323-ZP199)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
Tracers
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
Gene Related Products
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
Biospecimens
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
