Lenti of Mouse superoxide dismutase 2, mitochondrial (BC066063) ORF clone, mGFP Tagged
[CAT#: NEP-0521-R0776]
Mouse Superoxide Dismutase 2 (BC066063) ORF clone, mGFP Tagged
- Target:
- SOD2
- Gene/Insert name:
- SOD2
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse SOD2 mGFP tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
SOD2
Species
Mouse
Insert Size (bp)
546 bp
Tag
mGFP
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGTTGTGTCGGGCGGCGTGCAGCACGGGCAGGAGGCTGGGCCCTGTGGCCGGTGCCGCGGGCTCCCGGCACAAGCACAGCCTCCCAGACCTGCCTTACGACTATGGCGCGCTGGAGCCACACATTAACGCGCAGATCATGCAGCTGCACCACAGCAAGCACCACGCGGCCTACGTGAACAATCTCAACGCCACCGAGGAGAAGTACCACGAGGCTCTGGCCAAGGGAGATGTTACAACTCAGGTCGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGGGGACATATTAATCACACCATTTTCTGGACAAACCTGAGCCCTAAGGGTGGTGGAGAACCCAAAGGAGAGTTGCTGGAGGCTATCAAGCGTGACTTTGGGTCTTTTGAGAAGTTTAAGGAGAAGCTGACAGCCGTGTCTGTGGGAGTCCAAGGTTCAGGCTGGGGCTGGCTTGGCTTCAATAAGGAGCAAGGTCGCTTACAGATTGCTGCCTGCTCTAATCAGGACCCATTGCAAGGAACAACAGGCCTGTGTTCACTCTGCTCTTTCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmission; Cell Adhension Proteins
Relevant Diseases
Amyotrophic Lateral Sclerosis
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- iNeuMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- Mouse Anti-Human α-Synuclein Phospho (Tyr39) (CBP3706) (Cat#: NAB201250LS)
- iNeuMab™ Anti-Tau Antibody (NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- iNeuMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- iNeuMab™ Anti-Tau Antibody (NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- iNeuMab™ Anti-Tau Antibody (NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- iNeuMab™ Anti-GD2 Antibody (NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- iNeuMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- iNeuMab™ Anti-Alpha Synuclein BBB Shuttle Antibody (NRZP-1022-ZP4050) (Cat#: NRZP-1022-ZP4050)
- iNeuMab™ Anti-ApoC3 BBB Shuttle Antibody (NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
More
Cells
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- Mouse Microglia from C57BL/6 (Cat#: NCL-21P6-082)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
More
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
More
Tracers
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- Dextran, NHS Activated (Cat#: NRZP-0722-ZP124)
More
Gene Related Products
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
More
Biospecimens
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
More
Cell Assay Reagents
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
More
