Lenti of Human BCL2-associated X protein (BAX) transcript variant (NM_138763) ORF clone, mGFP Tagged
[CAT#: NEP-0521-R0115]
Human Bcl-2-Associated X Protein (NM_138763) ORF clone, mGFP Tagged
- Target:
- BAX
- Gene/Insert name:
- BAX
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human Bax mGFP tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
BAX
Species
Human
Insert Size (bp)
429 bp
Tag
mGFP
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGCCCACCAGCTCTGAGCAGATCATGAAGACAGGGGCCCTTTTGCTTCAGGGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCCGGGAGCGGCTGTTGGACTGGATCCAAGACCAGGGTGGTTGGGACGGCCTCCTCTCCTACTTTGGGACGCCCACGTGGCAGACCGTGACCATCTTTGTGGCGGGAGTGCTCACCGCCTCACTCACCATCTGGAAGAAGATGGGCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmission; Neural Signal Transduction; Metabolism
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
Cells
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Rat Retinal Muller Cell Line, Immortalized (Cat#: NCL-21P6-192)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- Human Microglia Cell Line HMC3, Immortalized (Cat#: NCL-2108P38)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
Tracers
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
Gene Related Products
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
Biospecimens
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
Cell Assay Reagents
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
