Lenti of Mouse ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase) (Uchl1) (NM_017237) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0271]
Rat Ubiquitin Carboxy-Terminal Hydrolase L1 (NM_017237) ORF clone, Myc-DDK Tagged
- Target:
- PGP9.5
- Gene/Insert name:
- UCHL1
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a rat UCHL1 Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
UCHL1
Species
Rat
Insert Size (bp)
669 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGCAGCTGAAACCGATGGAGATTAACCCCGAGATGCTGAACAAAGTGTTGGCCAAGCTGGGGGTCGCCGGGCAGTGGCGCTTTGCCGACGTGCTAGGGCTGGAGGAGGAGACTCTGGGCTCAGTGCCATCTCCTGCCTGCGCCCTGCTGCTGCTGTTTCCCCTCACGGCCCAGCATGAAAACTTCAGGAAAAAACAAATTGAGGAACTGAAGGGACAAGAAGTTAGCCCTAAAGTTTACTTCATGAAGCAGACCATCGGGAACTCCTGTGGTACCATTGGGCTGATCCACGCAGTGGCCAATAACCAAGACAAGCTGGAATTTGAGGATGGATCAGTCCTGAAACAGTTTCTGTCTGAAACGGAGAAGTTGTCCCCTGAAGACAGAGCCAAGTGTTTCGAGAAGAACGAGGCCATTCAGGCAGCCCATGACTCCGTGGCCCAGGAGGGCCAGTGCCGGGTAGACGACAAAGTGAATTTCCATTTTATCCTGTTCAATAATGTGGACGGCCACCTCTACGAGCTCGATGGGCGAATGCCTTTCCCGGTGAACCATGGCGCCAGTTCAGAGGACTCTCTGCTGCAGGATGCCGCCAAGGTCTGCAGAGAATTCACTGAGCGCGAGCAGGGAGAGGTCCGCTTCTCCGCAGTGGCTCTCTGCAAAGCAGCCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MQLKPMEINPEMLNKVLAKLGVAGQWRFADVLGLEEETLGSVPSPACALLLLFPLTAQHENFRKKQIEELKGQEVSPKVYFMKQTIGNSCGTIGLIHAVANNQDKLEFEDGSVLKQFLSETEKLSPEDRAKCFEKNEAIQAAHDSVAQEGQCRVDDKVNFHFILFNNVDGHLYELDGRMPFPVNHGASSEDSLLQDAAKVCREFTEREQGEVRFSAVALCKAATRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmission; Neural Signal Transduction
Relevant Diseases
Parkinson's Disease; Traumatic Brain Injury
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Target
PGP9.5
Official Name
UCHL1
Full Name
Ubiquitin carboxy-terminal hydrolase L1
Alternative Names
UCHL1; HEL-117; NDGOA; PARK5; PGP 9.5; PGP9.5; PGP95; Uch-L1; HEL-S-53; ubiquitin C-terminal hydrolase L1; SPG79
Publications
Publications (0)
Neural Cell Lines
Kits
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2275) (Cat#: NRP-0422-P2275)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
Cells
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Rat Glioma Cell Line C6 (Cat#: NCL2110P346)
- Green Fluorescent Alpha-synuclein SH-SY5Y Cell Line (Cat#: NCL2110P209)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- Mouse Microglia N9 (Cat#: NCL2110P073)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Rat Immortalized Retinal Muller Cell Line rMC-1 (Cat#: NCL-2106-S93)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
Kits
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
Tracers
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
Gene Related Products
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
Biospecimens
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
