Homo sapiens PARK2 co-regulated-like (PACRGL), transcript variant 3 (NM_001258345) clone, Untagged
[CAT#: NEP-0621-R0102]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- PACRG
- Gene/Insert name:
- PACRG
- Type:
- Human Untagged Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human PACRG untagged clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
PACRG
Species
Human
Insert Size (bp)
747 bp
Tag
Tag Free
Type
Human Untagged Clone
Vector
pCMV6
Vector Type
CMV
Cell Selection
ATGCAGAAATCAGAGGGCTCTGGAGGTACACAGTTGAAAAACAGAGCAACAGGTAACTATGATCAAAGGACATCATCAAGCACACAGTTAAAACACAGGAATGCAGTTCAGGGAAGCAAATCCTCATTGTCAACCAGTTCTCCAGAGTCTGCAAGAAAACTTCATCCTAGACCAAGTGATAAACTGAACCCTAAAACAATTAATCCGTTTGGTGAACAGTCACGAGTGCCTTCTGCATTTGCAGCTATTTACTCTAAAGGAGGTATTCCTTGCAGATTGGTACATGGTTCAGTAAAACACAGATTACAGTGGGAATGTCCTCCTGAAAGTCTTTCATTTGATCCACTTCTTATTACTTTAGCTGAGGGTCTGAGAGAGACTAAGCATCCATACACTTTTGTGTCAAAGGAGGGTTTTAGAGAATTACTTTTGGTCAAAGGTGCTCCTGAAAAAGCTATTCCTTTGCTACCTAGACTGATTCCTGTGCTAAAGGCAGCTCTGGTCCATTCGGATGATGAAGTGTTTGAAAGAGGATTGAATGCTCTAGTTCAGCTAAGTGTCGTTGTTGGTCCTTCTCTAAACGACCATCTGAAGCATCTGCTTACAAGCCTTTCCAAGAGATTAATGGACAAGAAATTCAAAGAGCCAATCACCAGCGCATTACAAAAGCTAGAGCAACATGGTGGAAGTGGGAGCCTTAGCATCATCAAATCTAAAATTCCAACATACTGCTCCATATGCTGTTGA
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Parkinson's Disease; Neurodegenerative Diseases
Research Areas
Neural Signal Transduction
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2275) (Cat#: NRP-0422-P2275)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- NeuroMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
Cells
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- iNeu™ Human Oligodendrocyte Progenitor Cells (OPCs) (Cat#: NCL-2103-P49)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- iNeu™ Human Schwann Cell (Cat#: NCL-2103-P63)
Kits
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
Tracers
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
Gene Related Products
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
