Rat glyceraldehyde-3-phosphate dehydrogenase (Gapdh) (NM_017008) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0450]
Rat Glyceraldehyde 3-Phosphate Dehydrogenase (NM_017008) ORF clone, Myc-DDK Tagged
- Target:
- GAPDH
- Gene/Insert name:
- GAPDH
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a rat GAPDH Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
GAPDH
Species
Rat
Insert Size (bp)
999 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGTGAAGGTCGGTGTGAACGGATTTGGCCGTATCGGACGCCTGGTTACCAGGGCTGCCTTCTCTTGTGACAAAGTGGACATTGTTGCCATCAACGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCAGTATGACTCTACCCACGGCAAGTTCAACGGCACAGTCAAGGCTGAGAATGGGAAGCTGGTCATCAACGGGAAACCCATCACCATCTTCCAGGAGCGAGATCCCGCTAACATCAAATGGGGTGATGCTGGTGCTGAGTATGTCGTGGAGTCTACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCACCTGAAGGGTGGGGCCAAAAGGGTCATCATCTCCGCCCCTTCCGCTGATGCCCCCATGTTTGTGATGGGTGTGAACCACGAGAAATATGACAACTCCCTCAAGATTGTCAGCAATGCATCCTGCACCACCAACTGCTTAGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATCGTGGAAGGGCTCATGACCACAGTCCATGCCATCACTGCCACTCAGAAGACTGTGGATGGCCCCTCTGGAAAGCTGTGGCGTGATGGCCGTGGGGCAGCCCAGAACATCATCCCTGCATCCACTGGTGCTGCCAAGGCTGTGGGCAAGGTCATCCCAGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTTCCTACCCCCAATGTATCCGTTGTGGATCTGACATGCCGCCTGGAGAAACCTGCCAAGTATGATGACATCAAGAAGGTGGTGAAGCAGGCGGCCGAGGGCCCACTAAAGGGCATCCTGGGCTACACTGAGGACCAGGTTGTCTCCTGTGACTTCAACAGCAACTCCCATTCTTCCACCTTTGATGCTGGGGCTGGCATTGCTCTCAATGACAACTTTGTGAAGCTCATTTCCTGGTATGACAATGAATATGGCTACAGCAACAGGGTGGTGGACCTCATGGCCTACATGGCCTCCAAGGAGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MVKVGVNGFGRIGRLVTRAAFSCDKVDIVAINDPFIDLNYMVYMFQYDSTHGKFNGTVKAENGKLVINGKPITIFQERDPANIKWGDAGAEYVVESTGVFTTMEKAGAHLKGGAKRVIISAPSADAPMFVMGVNHEKYDNSLKIVSNASCTTNCLAPLAKVIHDNFGIVEGLMTTVHAITATQKTVDGPSGKLWRDGRGAAQNIIPASTGAAKAVGKVIPELNGKLTGMAFRVPTPNVSVVDLTCRLEKPAKYDDIKKVVKQAAEGPLKGILGYTEDQVVSCDFNSNSHSSTFDAGAGIALNDNFVKLISWYDNEYGYSNRVVDLMAYMASKETRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmitter; Growth and Development
Relevant Diseases
Neurological Disorders; Huntington's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
Neural Cell Lines
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- Mouse Anti-Human α-Synuclein Phospho (Tyr39) (CBP3706) (Cat#: NAB201250LS)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
Cells
- Immortalized Human Cerebral Microvascular Endothelial Cells (Cat#: NCL-2108-P020)
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- iNeu™ Human Midbrain Dopaminergic Neurons (Cat#: NCL-21P6-003)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Sf295 Human Glioblastoma Cells (Cat#: NCL-2108P180)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Human Glioblastoma Cell Line SF126 (Cat#: NCL-2108P35)
Kits
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
Tracers
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
Gene Related Products
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
Biospecimens
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
Cell Assay Reagents
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
