Rat Kv channel interacting protein 3, calsenilin (Kcnip3) (NM_032462) ORF clone, Untagged
[CAT#: NEP-0421-R0404]
Rat Kcnip3 (NM_032462) ORF Clone, Untagged
- Target:
- KCNIP3
- Gene/Insert name:
- KCNIP3
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a rat KCNIP3 untagged clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
KCNIP3
Species
Rat
Insert Size (bp)
771 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGCAGAGGACCAAGGAAGCAATGAAGGCATCGGATGGCAGCCTCCTGGGAGACCCTGGGCGCATACCGCTGAGCAAGAGGGAAGGCATCAAGTGGCAGAGGCCACGGTTCACCCGCCAGGCCCTGATGCGTTGCTGCTTAATCAAGTGGATCCTGTCCAGTGCTGCCCCACAAGGCTCAGACAGCAGTGACAGTGAACTGGAGTTGTCCACGGTGCGCCATCAGCCAGAGGGCTTGGACCAGCTACAGGCCCAAACCAAGTTCACCAAGAAGGAGCTGCAGTCCCTGTACCGAGGCTTCAAGAACGAATGTCCCACGGGCCTGGTCGATGAAGATACCTTCAAACTCATTTATTCCCAGTTCTTCCCCCAGGGAGATGCCACCACCTATGCACACTTCCTCTTCAATGCCTTCGATGCTGATGGGAACGGGGCCATCCACTTTGAGGACTTTGTGGTTGGGCTCTCCATCCTGCTTCGAGGGACCGTCCATGAGAAGCTCAAGTGGGCCTTCAATCTCTACGACATCAACAAGGACGGTTACATCACCAAAGAGGAGATGCTGGCCATCATGAAGTCCATCTACGACATGATGGGCCGCCACACCTACCCTATCCTGCGAAAGGACGCACCTCTGGAGCATGTGGAGAGGTTCTTCCAGAAAATGGACAGGAACCAGGATGGAGTAGTGACTATTGATGAATTTCTGGAGACTTGTCAGAAGGACGAGAACATCATGAGCTCCATGCAGCTGTTTGAGAACGTCATCTAGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Somatosensory System
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -28°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-CD32b Antibody(NRP-0422-P1803) (Cat#: NRP-0422-P1803)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
Cells
- Rat Microglia Cell Line HAPI, Immortalized (Cat#: NCL2110P015)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- iNeu™ Microglia (Cat#: NCL-7P018)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- iNeu™ Human Sensory Neurons (Cat#: NCL-2103-P62)
- Green Fluorescent Tau SH-SY5Y cell Line (Cat#: NCL2110P219)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
Kits
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
Tracers
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
Gene Related Products
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
Biospecimens
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
Cell Assay Reagents
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
