Lenti of Human Parkinson disease (autosomal recessive, early onset) 7 (PARK7), transcript variant (NM_001123377) ORF clone, mGFP Tagged
[CAT#: NEP-0621-R0126]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- PARK7
- Gene/Insert name:
- PARK7
- Type:
- Human Tagged ORF Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human PARK7 mGFP tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
PARK7
Species
Human
Insert Size (bp)
567 bp
Tag
mGFP
Type
Human Tagged ORF Clone
Vector
pLenti
Cell Selection
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCTTCCAAAAGAGCTCTGGTCATCCTGGCTAAAGGAGCAGAGGAAATGGAGACGGTCATCCCTGTAGATGTCATGAGGCGAGCTGGGATTAAGGTCACCGTTGCAGGCCTGGCTGGAAAAGACCCAGTACAGTGTAGCCGTGATGTGGTCATTTGTCCTGATGCCAGCCTTGAAGATGCAAAAAAAGAGGGACCATATGATGTGGTGGTTCTACCAGGAGGTAATCTGGGTGCACAGAATTTATCTGAGTCTGCTGCTGTGAAGGAGATACTGAAGGAGCAGGAAAACCGGAAGGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATGAAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAAATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGACGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGCTTGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGGCTCCACTTGTTCTTAAAGACACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
ORF Nucleotide Sequence
MASKRALVILAKGAEEMETVIPVDVMRRAGIKVTVAGLAGKDPVQCSRDVVICPDASLEDAKKEGPYDVVVLPGGNLGAQNLSESAAVKEILKEQENRKGLIAAICAGPTALLAHEIGFGSKVTTHPLAKDKMMNGGHYTYSENRVEKDGLILTSRGPGTSFEFALAIVEALNGKEVAAQVKAPLVLKDTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Parkinson's Disease; Neurological Disorders
Research Areas
Metabolism; Growth and Development
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
Kits
Neural Cell Lines
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-CD32b Antibody(NRP-0422-P1803) (Cat#: NRP-0422-P1803)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- Mouse Anti-SCN5A Monoclonal Antibody (CBP708) (Cat#: NAB-0720-Z2720)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
Cells
- iNeu™ Microglia (Cat#: NCL-7P018)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- Human Microglia Cell Line HMC3, Immortalized (Cat#: NCL-2108P38)
- Mouse Hippocampal Neuron Cell HT22 (Cat#: NCL2110P001)
- Human Glioblastoma Cell Line SF126 (Cat#: NCL-2108P35)
- Human Hippocampal Neuron Cells HPPNCs (Cat#: NCL2110P106)
- Rat Muller Cell (Cat#: NCL2110P040)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- iNeu™ Human Midbrain Dopaminergic Neurons (Cat#: NCL-21P6-003)
Kits
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
Tracers
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
Gene Related Products
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
Biospecimens
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
