Lenti of Rat superoxide dismutase 3, extracellular (Sod3) (NM_012880) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0809]
Rat Extracellular Superoxide Dismutase [Cu-Zn] (NM_012880) ORF clone, Myc-DDK Tagged
- Target:
- SOD3
- Gene/Insert name:
- SOD3
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a rat SOD3 Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
SOD3
Species
Rat
Insert Size (bp)
732 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGTGGCCTTCTTGTTCTGCAACCTGCTACTGGTGGCCTGTGGCTCTGTCACCTGGACCATGTCAGATACCGGAGAGTCCGGTGTCGACTTAGCAGACCGGCTTGACCTGGTTGAGAAGATAGGCGACACGCACTCCAAAGACCTGGAGATCTGGATGGAGCTAGGAAAACAACGGGAGGCGGATGCCAGGGAGATGCACGCAGTCTGCAGGGTACAGCCCTCAGCCATGCTGCCTCCCGATCAGCCACAGATCACAGGCTTGGTCCTCTTCCGGCAGCTGGGGCCCAGCTCCAGACTTGAGGCCTCCTTCAATCTGGAGGGCTTCCCAGCCGAGCAGAACACCTCCAACCACGCCATCCACGTGCATGAGTTCGGGGACCTGAGCCAGGGCTGCGAGTCCACCGGACCACACTACAACCCGCTGGGTGTGCCGCACCCACAGCACCCGGGGGACTTCGGCAACTTCGTGGTGCGCGATGGCCGCCTTTGGAAGCATCGAATGGGCCTGGCCACGTCACTGGCCGGACCGCACTCGATCTTGGGCCGCGCTGTGGTGGTCCACGCTGGCGAGGACGACCTGGGTAAAGGTGGCAACCAGGCCAGCGTGCAGAACGGCAACGCAGGTCGCCGGCTCGCCTGCTGCGTGGTAGGCACCAGCAACTCGGAGGCCTGGGAGAGCCAGACAAAGGAGCGCAAGAAGCGGCGGCGGGAGAGCGAGTGCAAGACCACTACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MVAFLFCNLLLVACGSVTWTMSDTGESGVDLADRLDLVEKIGDTHSKDLEIWMELGKQREADAREMHAVCRVQPSAMLPPDQPQITGLVLFRQLGPSSRLEASFNLEGFPAEQNTSNHAIHVHEFGDLSQGCESTGPHYNPLGVPHPQHPGDFGNFVVRDGRLWKHRMGLATSLAGPHSILGRAVVVHAGEDDLGKGGNQASVQNGNAGRRLACCVVGTSNSEAWESQTKERKKRRRESECKTTTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmission; Cell Adhension Proteins
Relevant Diseases
Amyotrophic Lateral Sclerosis
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2275) (Cat#: NRP-0422-P2275)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1684) (Cat#: NRP-0422-P1684)
Cells
- Human Glioblastoma Cell Line SF126 (Cat#: NCL-2108P35)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Green Fluorescent Tau SH-SY5Y cell Line (Cat#: NCL2110P219)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
Kits
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
Tracers
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
Gene Related Products
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
Cell Assay Reagents
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
