Mouse superoxide dismutase 3, extracellular (Sod3) (NM_011435) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0801]
Mouse Extracellular Superoxide Dismutase [Cu-Zn] (NM_011435) ORF clone, Myc-DDK Tagged
- Target:
- SOD3
- Gene/Insert name:
- SOD3
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse SOD3 Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
SOD3
Species
Mouse
Insert Size (bp)
756 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGTTGGCCTTCTTGTTCTACGGCTTGCTACTGGCGGCCTGTGGCTCTGTCACCATGTCAGATCCAGGGGAGTCCAGCTTCGACCTAGCAGACAGGCTTGACCCGGTTGAGAAGATAGACAGGCTTGACCTGGTTGAGAAGATAGGCGACACGCATGCCAAAGTGCTGGAGATCTGGATGGAGCTAGGACGACGAAGGGAGGTGGATGCTGCCGAGATGCATGCAATCTGCAGGGTACAACCATCAGCCACGCTGCCACCGGATCAGCCACAGATCACCGGCTTGGTTCTCTTCCGGCAGCTGGGGCCGGGCTCCAGGCTTGAGGCCTATTTCAGTCTGGAGGGCTTCCCAGCTGAGCAGAACGCCTCCAACCGTGCCATCCACGTGCATGAGTTCGGGGACCTGAGCCAGGGCTGCGATTCCACCGGCCCGCACTACAACCCGATGGAGGTGCCGCACCCTCAGCACCCGGGCGACTTTGGCAACTTCGTGGTGCGCAACGGCCAGCTCTGGAGGCATCGCGTCGGCCTGACCGCGTCGCTGGCCGGACCGCACTCCATCTTGGGCCGCTCTGTGGTGGTCCACGCCGGCGAGGACGACCTGGGTAAAGGTGGCAACCAGGCCAGCCTGCAGAACGGCAATGCAGGTCGCCGGCTCGCCTGCTGCGTGGTAGGCACCAGCAGCTCCGCCGCCTGGGAGAGCCAGACAAAGGAGCGCAAGAAGCGGCGGCGGGAGAGCGAGTGCAAGACCACTACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MLAFLFYGLLLAACGSVTMSDPGESSFDLADRLDPVEKIDRLDLVEKIGDTHAKVLEIWMELGRRREVDAAEMHAICRVQPSATLPPDQPQITGLVLFRQLGPGSRLEAYFSLEGFPAEQNASNRAIHVHEFGDLSQGCDSTGPHYNPMEVPHPQHPGDFGNFVVRNGQLWRHRVGLTASLAGPHSILGRSVVVHAGEDDLGKGGNQASLQNGNAGRRLACCVVGTSSSAAWESQTKERKKRRRESECKTTTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmission; Cell Adhension Proteins
Relevant Diseases
Amyotrophic Lateral Sclerosis
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-GD2 Antibody(NRZP-1222-ZP767) (Cat#: NRZP-1222-ZP767)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
Cells
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Mouse Microglia from C57BL/6 (Cat#: NCL-21P6-082)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Green Fluorescent Tau SH-SY5Y cell Line (Cat#: NCL2110P219)
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- Mouse Microglia N9 (Cat#: NCL2110P073)
Kits
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
Tracers
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
Gene Related Products
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
Biospecimens
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
Cell Assay Reagents
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
