Human kallikrein-related peptidase 6 (KLK6) transcript variant A (NM_002774) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0162]
Human Kallikrein-6 (NM_002774) ORF clone, Myc-DDK Tagged
- Target:
- Kallikrein 6
- Gene/Insert name:
- KLK6
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human KLK6 Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
KLK6
Species
Human
Insert Size (bp)
732 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGAAGAAGCTGATGGTGGTGCTGAGTCTGATTGCTGCAGCCTGGGCAGAGGAGCAGAATAAGTTGGTGCATGGCGGACCCTGCGACAAGACATCTCACCCCTACCAAGCTGCCCTCTACACCTCGGGCCACTTGCTCTGTGGTGGGGTCCTTATCCATCCACTGTGGGTCCTCACAGCTGCCCACTGCAAAAAACCGAATCTTCAGGTCTTCCTGGGGAAGCATAACCTTCGGCAAAGGGAGAGTTCCCAGGAGCAGAGTTCTGTTGTCCGGGCTGTGATCCACCCTGACTATGATGCCGCCAGCCATGACCAGGACATCATGCTGTTGCGCCTGGCACGCCCAGCCAAACTCTCTGAACTCATCCAGCCCCTTCCCCTGGAGAGGGACTGCTCAGCCAACACCACCAGCTGCCACATCCTGGGCTGGGGCAAGACAGCAGATGGTGATTTCCCTGACACCATCCAGTGTGCATACATCCACCTGGTGTCCCGTGAGGAGTGTGAGCATGCCTACCCTGGCCAGATCACCCAGAACATGTTGTGTGCTGGGGATGAGAAGTACGGGAAGGATTCCTGCCAGGGTGATTCTGGGGGTCCGCTGGTATGTGGAGACCACCTCCGAGGCCTTGTGTCATGGGGTAACATCCCCTGTGGATCAAAGGAGAAGCCAGGAGTCTACACCAACGTCTGCAGATACACGAACTGGATCCAAAAAACCATTCAGGCCAAGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Metabolism
Relevant Diseases
Parkinson's Disease; Alzheimer's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Alpha Synuclein BBB Shuttle Antibody(NRZP-1022-ZP4050) (Cat#: NRZP-1022-ZP4050)
- NeuroMab™ Anti-TREM2 BBB Shuttle Antibody(NRZP-1022-ZP4114) (Cat#: NRZP-1022-ZP4114)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- Mouse Anti-Human α-Synuclein Phospho (Tyr39) (CBP3706) (Cat#: NAB201250LS)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1760) (Cat#: NRP-0422-P1760)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- Mouse Anti-SCN5A Monoclonal Antibody (CBP708) (Cat#: NAB-0720-Z2720)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
Cells
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Rat Retinal Muller Cell Line, Immortalized (Cat#: NCL-21P6-192)
- Sf295 Human Glioblastoma Cells (Cat#: NCL-2108P180)
- Mouse Microglia N9 (Cat#: NCL2110P073)
- Mouse Microglia from C57BL/6 (Cat#: NCL-21P6-082)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
- Rat Muller Cell (Cat#: NCL2110P040)
- iNeu™ Human Oligodendrocyte Progenitor Cells (OPCs) (Cat#: NCL-2103-P49)
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
Tracers
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
Gene Related Products
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
Biospecimens
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
Cell Assay Reagents
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
