Human kallikrein-related peptidase 6 (KLK6) transcript variant A (NM_002774) ORF clone, Untagged
[CAT#: NEP-0521-R0179]
Human Kallikrein-6 (NM_002774) ORF clone, Untagged
- Target:
- Kallikrein 6
- Gene/Insert name:
- KLK6
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human KLK6 untagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
KLK6
Species
Human
Insert Size (bp)
1530 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Ampicillin (100 ug/mL)
ORF Nucleotide Sequence
ATGAAGAAGCTGATGGTGGTGCTGAGTCTGATTGCTGCAGCCTGGGCAGAGGAGCAGAATAAGTTGGTGCATGGCGGACCCTGCGACAAGACATCTCACCCCTACCAAGCTGCCCTCTACACCTCGGGCCACTTGCTCTGTGGTGGGGTCCTTATCCATCCACTGTGGGTCCTCACAGCTGCCCACTGCAAAAAACCGAATCTTCAGGTCTTCCTGGGGAAGCATAACCTTCGGCAAAGGGAGAGTTCCCAGGAGCAGAGTTCTGTTGTCCGGGCTGTGATCCACCCTGACTATGATGCCGCCAGCCATGACCAGGACATCATGCTGTTGCGCCTGGCACGCCCAGCCAAACTCTCTGAACTCATCCAGCCCCTTCCCCTGGAGAGGGACTGCTCAGCCAACACCACCAGCTGCCACATCCTGGGCTGGGGCAAGACAGCAGATGGTGATTTCCCTGACACCATCCAGTGTGCATACATCCACCTGGTGTCCCGTGAGGAGTGTGAGCATGCCTACCCTGGCCAGATCACCCAGAACATGTTGTGTGCTGGGGATGAGAAGTACGGGAAGGATTCCTGCCAGGGTGATTCTGGGGGTCCGCTGGTATGTGGAGACCACCTCCGAGGCCTTGTGTCATGGGGTAACATCCCCTGTGGATCAAAGGAGAAGCCAGGAGTCTACACCAACGTCTGCAGATACACGAACTGGATCCAAAAAACCATTCAGGCCAAGTGA
Restriction Sites
NotI-NotI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Metabolism
Relevant Diseases
Parkinson's Disease; Alzheimer's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- Mouse Anti-SCN5A Monoclonal Antibody (CBP708) (Cat#: NAB-0720-Z2720)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-Alpha Synuclein BBB Shuttle Antibody(NRZP-1022-ZP4050) (Cat#: NRZP-1022-ZP4050)
Cells
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- iNeu™ Human Schwann Cell (Cat#: NCL-2103-P63)
- Rat Glioma Cell Line C6 (Cat#: NCL2110P346)
- Human Microglia Cell Line HMC3, Immortalized (Cat#: NCL-2108P38)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Green Fluorescent Alpha-synuclein SH-SY5Y Cell Line (Cat#: NCL2110P209)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
Kits
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
Tracers
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
Gene Related Products
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
Cell Assay Reagents
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
