Lenti of Human myelin basic protein (MBP) transcript variant 4 (NM_001025092) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0388]
Human Myelin Basic Protein (MBP) (NM_001025092) ORF clone, Myc-DDK Tagged
- Target:
- Myelin Basic Protein
- Gene/Insert name:
- MBP
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human MBP Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
MBP
Species
Human
Insert Size (bp)
480 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGACTCACACCACCCGGCAAGAACTGCTCACTACGGCTCCCTGCCCCAGAAGTCACACGGCCGGACCCAAGATGAAAACCCCGTAGTCCACTTCTTCAAGAACATTGTGACGCCTCGCACACCACCCCCGTCGCAGGGAAAGGGGGCCGAAGGCCAGAGACCAGGATTTGGCTACGGAGGCAGAGCGTCCGACTATAAATCGGCTCACAAGGGATTCAAGGGAGTCGATGCCCAGGGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGAGATAGTCGCTCTGGATCACCCATGGCTAGACGCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MASQKRPSQRHGSKYLATASTMDHARHGFLPRHRDTGILDSIGRFFGGDRGAPKRGSGKDSHHPARTAHYGSLPQKSHGRTQDENPVVHFFKNIVTPRTPPPSQGKGAEGQRPGFGYGGRASDYKSAHKGFKGVDAQGTLSKIFKLGGRDSRSGSPMARRTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Metabolism
Relevant Diseases
Parkinson's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-CD32b Antibody(NRP-0422-P1803) (Cat#: NRP-0422-P1803)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-TREM2 BBB Shuttle Antibody(NRZP-1022-ZP4114) (Cat#: NRZP-1022-ZP4114)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
Cells
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- Rat Glioma Cell Line C6 (Cat#: NCL2110P346)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
Tracers
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
Gene Related Products
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
Cell Assay Reagents
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
