Lenti of Human myelin basic protein (MBP) transcript variant 4 (NM_001025092) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0388]
Human Myelin Basic Protein (MBP) (NM_001025092) ORF clone, Myc-DDK Tagged
- Target:
- Myelin Basic Protein
- Gene/Insert name:
- MBP
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a human MBP Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
MBP
Species
Human
Insert Size (bp)
480 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGACTCACACCACCCGGCAAGAACTGCTCACTACGGCTCCCTGCCCCAGAAGTCACACGGCCGGACCCAAGATGAAAACCCCGTAGTCCACTTCTTCAAGAACATTGTGACGCCTCGCACACCACCCCCGTCGCAGGGAAAGGGGGCCGAAGGCCAGAGACCAGGATTTGGCTACGGAGGCAGAGCGTCCGACTATAAATCGGCTCACAAGGGATTCAAGGGAGTCGATGCCCAGGGCACGCTTTCCAAAATTTTTAAGCTGGGAGGAAGAGATAGTCGCTCTGGATCACCCATGGCTAGACGCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
MASQKRPSQRHGSKYLATASTMDHARHGFLPRHRDTGILDSIGRFFGGDRGAPKRGSGKDSHHPARTAHYGSLPQKSHGRTQDENPVVHFFKNIVTPRTPPPSQGKGAEGQRPGFGYGGRASDYKSAHKGFKGVDAQGTLSKIFKLGGRDSRSGSPMARRTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neural Signal Transduction; Metabolism
Relevant Diseases
Parkinson's Disease; Neurodegenerative Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1684) (Cat#: NRP-0422-P1684)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
Cells
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Mouse Hippocampal Neuron Cell HT22 (Cat#: NCL2110P001)
- Mouse Microglia Cell Line BV-2, Immortalized (Cat#: NCL2110P153)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- Sf295 Human Glioblastoma Cells (Cat#: NCL-2108P180)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
Kits
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
Tracers
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
Gene Related Products
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
Cell Assay Reagents
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
