Lenti of Park7 (mGFP-tagged) - Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) ORF clone, mGFP Tagged
[CAT#: NEP-0621-R0131]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- PARK7
- Gene/Insert name:
- PARK7
- Type:
- Mouse Tagged ORF Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse PARK7 mGFP tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
PARK7
Species
Mouse
Insert Size (bp)
567 bp
Tag
mGFP
Type
Mouse Tagged ORF Clone
Vector
pLenti
E. coli Selection
Puromycin
Cell Selection
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCTTCCAAAAGAGCTCTGGTCATCCTGGCCAAAGGAGCAGAGGAGATGGAGACAGTGATTCCTGTGGATGTCATGCGGCGAGCCGGGATCAAAGTCACTGTTGCAGGCTTGGCTGGGAAGGACCCCGTGCAGTGTAGCCGTGATGTAATGATTTGTCCAGATACCAGTCTGGAAGATGCAAAAACGCAGGGACCATACGATGTGGTGGTTCTTCCAGGAGGAAATCTGGGTGCACAGAATTTATCTGAGTCGCCTATGGTGAAGGAGATCCTCAAGGAGCAGGAGAGCAGGAAGGGCCTCATAGCTGCCATCTGTGCAGGTCCTACGGCTCTGTTGGCTCACGAAGTAGGTTTTGGATGCAAGGTCACAACACACCCACTGGCTAAGGACAAAATGATGAATGGCAGTCACTACAGCTACTCAGAGAGCCGCGTGGAGAAGGACGGCCTGATCCTCACCAGCCGCGGGCCGGGGACCAGCTTTGAGTTTGCACTAGCCATTGTGGAGGCACTCGTGGGGAAAGACATGGCCAACCAAGTGAAGGCACCGCTTGTTCTCAAAGACACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
ORF Nucleotide Sequence
MASKRALVILAKGAEEMETVIPVDVMRRAGIKVTVAGLAGKDPVQCSRDVMICPDTSLEDAKTQGPYDVVVLPGGNLGAQNLSESPMVKEILKEQESRKGLIAAICAGPTALLAHEVGFGCKVTTHPLAKDKMMNGSHYSYSESRVEKDGLILTSRGPGTSFEFALAIVEALVGKDMANQVKAPLVLKDTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Parkinson's Disease; Neurological Disorders
Research Areas
Metabolism; Growth and Development
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
Neural Cell Lines
Kits
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Mouse Anti-LRP1 Monoclonal Antibody (CBP3363) (Cat#: NAB-0720-Z6479)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- NeuroMab™ Anti-CD32b Antibody(NRP-0422-P1803) (Cat#: NRP-0422-P1803)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
Cells
- Rat Retinal Muller Cell Line, Immortalized (Cat#: NCL-21P6-192)
- Rat Immortalized Retinal Muller Cell Line rMC-1 (Cat#: NCL-2106-S93)
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- Mouse Midbrain Dopaminergic Neuron Cell MN9D (Cat#: NCL2110P059)
- iNeu™ Human Neural Stem Cell Line (Cat#: NCL200552ZP)
- Rat Muller Cell (Cat#: NCL2110P040)
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
Kits
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
Tracers
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- AAV-EF1a-mCherry-flex-dtA (Cat#: NRZP-0622-ZP616)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
Gene Related Products
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
Cell Assay Reagents
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP498)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
