Mouse crystallin, alpha B (Cryab), transcript variant 1 (NM_001289782) clone, Untagged
[CAT#: NEP-0621-R0210]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- Alpha B Crystallin
- Gene/Insert name:
- CRYAB
- Type:
- Mouse Untagged Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse CRYAB untagged clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
CRYAB
Species
Mouse
Insert Size (bp)
528 bp
Tag
Tag Free
Type
Mouse Untagged Clone
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Neomycin
Cell Selection
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCTTCCCCTTCCACTCCCCAAGCCGCCTCTTCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTTCTCAACAGCCACTTCCCTGAGCCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATTGACACCGGACTCTCAGAGATGCGTTTGGAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCTCTCCGGAGGAACTCAAAGTCAAGGTTCTGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCAGGACGAACATGGCTTCATCTCCAGGGAGTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTCACCATCACTTCATCCCTGTCATCTGATGGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCCCTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGTAGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Neural Diseases
Research Areas
Growth and Development
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3503) (Cat#: NRZP-1022-ZP3503)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- iNeuMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
Cells
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Mouse Glioma Cell Line GL-261-Luc (Cat#: NCL-2108P06)
- iNeu™ Human Schwann Cell (Cat#: NCL-2103-P63)
- Human Glial (Oligodendrocytic) Hybrid Cell Line (MO3.13) (Cat#: NCL-2108P34)
- iNeu™ Human Sensory Neurons (Cat#: NCL-2103-P62)
- Mouse Microglia N9 (Cat#: NCL2110P073)
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- Rat Glioma Cell Line C6 (Cat#: NCL2110P346)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
Kits
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
Tracers
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- Dextran, Cy5 Labeled, 2000 kDa (Cat#: NRZP-0722-ZP22)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- Dextran-FITC (Cat#: NTA-2011-ZP110)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
Gene Related Products
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
Biospecimens
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
Cell Assay Reagents
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
