Mouse crystallin, alpha B (Cryab), transcript variant 3 (NM_001289784) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0621-R0184]
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
- Target:
- Alpha B Crystallin
- Gene/Insert name:
- CRYAB
- Type:
- Mouse Tagged ORF Clone
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse CRYAB Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
CRYAB
Species
Mouse
Insert Size (bp)
528 bp
Tag
Myc-DDK
Type
Mouse Tagged ORF Clone
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Neomycin
Cell Selection
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCTTCCCCTTCCACTCCCCAAGCCGCCTCTTCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTTCTCAACAGCCACTTCCCTGAGCCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATTGACACCGGACTCTCAGAGATGCGTTTGGAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCTCTCCGGAGGAACTCAAAGTCAAGGTTCTGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCAGGACGAACATGGCTTCATCTCCAGGGAGTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTCACCATCACTTCATCCCTGTCATCTGATGGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCCCTGAGCGCACCATTCCCATCACCCGTGAAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
ORF Nucleotide Sequence
MDIAIHHPWIRRPFFPFHSPSRLFDQFFGEHLLESDLFSTATSLSPFYLRPPSFLRAPSWIDTGLSEMRLEKDRFSVNLDVKHFSPEELKVKVLGDVIEVHGKHEERQDEHGFISREFHRKYRIPADVDPLTITSSLSSDGVLTVNGPRKQVSGPERTIPITREEKPAVAAAPKKTRTRPLEQKLISEEDLAANDILDYKDDDDKV
Protein Sequence
SgfI-MluI
Application Notes
Ion-exchange column purified
Purification
Neural Diseases
Research Areas
Growth and Development
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-TREM2 BBB Shuttle Antibody(NRZP-1022-ZP4114) (Cat#: NRZP-1022-ZP4114)
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1684) (Cat#: NRP-0422-P1684)
- NeuroMab™ Anti-EPHB2 Antibody(NRP-0422-P1220) (Cat#: NRP-0422-P1220)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
Cells
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- Rat Glioma Cell Line C6 (Cat#: NCL2110P346)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Green Fluorescent Tau SH-SY5Y cell Line (Cat#: NCL2110P219)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Mouse Hippocampal Neuron Cell HT22 (Cat#: NCL2110P001)
- Rat Retinal Muller Cell Line, Immortalized (Cat#: NCL-21P6-192)
- Human Brain Astroblastoma U-87 MG (Cat#: NCL2110P117)
- Mouse Glioma Cell Line GL261-GFP (Cat#: NCL-2108P04)
Kits
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
Tracers
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- pAAV-syn-jGCaMP8m-WPRE (Cat#: NTA-2106-P062)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
Gene Related Products
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
Biospecimens
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
Cell Assay Reagents
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
