Mouse interleukin 1 beta (Il1b) (NM_008361) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0145]
Mouse Interleukin 1 beta (NM_008361) ORF clone, Myc-DDK Tagged
- Target:
- Il-1β
- Gene/Insert name:
- IL1B
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse IL1B Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
IL1B
Species
Mouse
Insert Size (bp)
807 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCAACTGTTCCTGAACTCAACTGTGAAATGCCACCTTTTGACAGTGATGAGAATGACCTGTTCTTTGAAGTTGACGGACCCCAAAAGATGAAGGGCTGCTTCCAAACCTTTGACCTGGGCTGTCCAGATGAGAGCATCCAGCTTCAAATCTCACAGCAGCACATCAACAAGAGCTTCAGGCAGGCAGTATCACTCATTGTGGCTGTGGAGAAGCTGTGGCAGCTACCTGTGTCTTTCCCGTGGACCTTCCAGGATGAGGACATGAGCACCTTCTTTTCCTTCATCTTTGAAGAAGAGCCCATCCTCTGTGACTCATGGGATGATGATGATAACCTGCTGGTGTGTGACGTTCCCATTAGACAGCTGCACTACAGGCTCCGAGATGAACAACAAAAAAGCCTCGTGCTGTCGGACCCATATGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCAACAAGTGATATTCTCCATGAGCTTTGTACAAGGAGAACCAAGCAACGACAAAATACCTGTGGCCTTGGGCCTCAAAGGAAAGAATCTATACCTGTCCTGTGTAATGAAAGACGGCACACCCACCCTGCAGCTGGAGAGTGTGGATCCCAAGCAATACCCAAAGAAGAAGATGGAAAAGCGGTTTGTCTTCAACAAGATAGAAGTCAAGAGCAAAGTGGAGTTTGAGTCTGCAGAGTTCCCCAACTGGTACATCAGCACCTCACAAGCAGAGCACAAGCCTGTCTTCCTGGGAAACAACAGTGGTCAGGACATAATTGACTTCACCATGGAATCTGTGTCTTCCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Metabolism; Neuron
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
- NeuroMab™ Anti-Alpha Synuclein Antibody(NRP-0422-P614) (Cat#: NRP-0422-P614)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P517) (Cat#: NRP-0422-P517)
- NeuroMab™ Anti-ApoC3 BBB Shuttle Antibody(NRZP-1022-ZP3505) (Cat#: NRZP-1022-ZP3505)
- NeuroMab™ Anti-TREM2 Antibody(NRP-0422-P792) (Cat#: NRP-0422-P792)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
- NeuroMab™ Anti-TREM2 BBB Shuttle Antibody(NRZP-1022-ZP4114) (Cat#: NRZP-1022-ZP4114)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Anti-CD32b Antibody(NRP-0422-P1803) (Cat#: NRP-0422-P1803)
- NeuroMab™ Anti-SEZ6 Antibody(NRP-0422-P515) (Cat#: NRP-0422-P515)
Cells
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- Mouse Retinal Ganglion Cells (Cat#: NCL2110P145)
- iNeu™ Human Motor Neurons (Cat#: NCL-2103-P71)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- Mouse Midbrain Dopaminergic Neuron Cell MN9D (Cat#: NCL2110P059)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Mouse Glioma Cell Line GL261-GFP (Cat#: NCL-2108P04)
- iNeu™ Human Sensory Neurons (Cat#: NCL-2103-P62)
Kits
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
Tracers
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- VSV-eGFP (Cat#: NTA-2011-ZP20)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- Dextran, NHS Activated, 40 kDa (Cat#: NRZP-0722-ZP124)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
Gene Related Products
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- ABCA1 Antisense Oligonucleotide (NV-2106-P27) (Cat#: NV-2106-P27)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
Biospecimens
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
Cell Assay Reagents
- NeuroPro™ Anti-ASA BBB Shuttle Protein (Cat#: NRZP-0423-ZP504)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
