Rat superoxide dismutase 1, soluble (Sod1) (NM_017050) ORF clone, Untagged
[CAT#: NEP-0521-R0763]
Rat Superoxide Dismutase 1 (NM_017050) ORF clone, Untagged
- Target:
- SOD1
- Gene/Insert name:
- SOD1
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a rat SOD1 untagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
SOD1
Species
Rat
Insert Size (bp)
465 bp
Tag
Tag Free
Type
Expression Vector/ Viral Particle
Vector
pCMV6
Vector Type
CMV
Virus Type
CMV
E. coli Selection
Kanamycin (25 ug/mL)
Cell Selection
Neomycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCGATGAAGGCCGTGTGCGTGCTGAAGGGCGACGGTCCGGTGCAGGGCGTCATTCACTTCGAGCAGAAGGCAAGCGGTGAACCAGTTGTGGTGTCAGGACAGATTACAGGATTAACTGAAGGCGAGCATGGGTTCCATGTCCATCAATATGGGGACAATACACAAGGCTGTACCACTGCAGGACCTCATTTTAATCCTCACTCTAAGAAACATGGCGGTCCAGCGGATGAAGAGAGGCATGTTGGAGACCTGGGCAATGTGGCTGCTGGAAAGGACGGTGTGGCCAATGTGTCCATTGAAGATCGTGTGATCTCACTCTCAGGAGAGCATTCCATCATTGGCCGTACTATGGTGGTCCACGAGAAACAAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACTGGAAATGCTGGAAGCCGCTTGGCTTGTGGTGTGATTGGGATTGCCCAATAAACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Neurotransmission; Cell Adhension Proteins
Relevant Diseases
Amyotrophic Lateral Sclerosis
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Kits
Neural Genes
Neural Cell Lines
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1686) (Cat#: NRP-0422-P1686)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1684) (Cat#: NRP-0422-P1684)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P1683) (Cat#: NRP-0422-P1683)
- NeuroMab™ Anti-CD20 Antibody(NRP-0422-P1230) (Cat#: NRP-0422-P1230)
- NeuroMab™ Anti-Integrin αvβ8 BBB Shuttle Antibody(NRZP-1222-ZP1218) (Cat#: NRZP-1222-ZP1218)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-FGFR1 Antibody(NRP-0422-P1244) (Cat#: NRP-0422-P1244)
- NeuroMab™ Rabbit Anti-LRRK2 Monoclonal Antibody (CBP1887) (Cat#: NAB-08-PZ735)
- NeuroMab™ Rabbit Anti-Alpha-synuclein (CBP1631) (Cat#: NAB-08-PZ079)
- NeuroMab™ Anti-pTau Antibody(NRP-0422-P1719) (Cat#: NRP-0422-P1719)
Cells
- Human Neurons Isolated from Cortex (Cat#: NCL-21P6-023)
- Mouse Microglia N9 (Cat#: NCL2110P073)
- Rat Glioma Cell Line C6 (Cat#: NCL2110P346)
- Human Astrocytes, Immortalized (Cat#: NCL-2105-P182-AM)
- Human Blood Brain Barrier Model (Cat#: NCL-2103-P187)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
- Human Dental Pulp Stem Cells (Cat#: NRZP-1122-ZP113)
- Human Retinal Epithelial Cell ARPE-19 (Cat#: NCL2110P069)
- Rat Schwann Cells RSC96, Immortalized (Cat#: NCL-2108P21)
- Mouse Glioma Cell Line GL261 (Cat#: NCL-2108P28)
Kits
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
Tracers
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- AAV2 Full Capsids, Reference Standards (Cat#: NTC2101070CR)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- AAV2/9-hSyn-Flpo-EGFP-WPRE-pA (Cat#: NTA-2012-ZP149)
- pAAV-syn-FLEX-jGCaMP8s-WPRE (Cat#: NTA-2106-P066)
- pAAV-EF1a-DIO-EGFP-WPRE (Cat#: NTA-2012AD-P285)
- AAV2/9-hEF1a-fDIO-eNpHR 3.0-mCherry-WPRE-pA (Cat#: NTA-2012-ZP78)
- pAAV-syn-FLEX-jGCaMP8m-WPRE (Cat#: NTA-2106-P065)
- pAAV-hSyn-DIO-XCaMP-R-WPRE (Cat#: NTA-2012AD-P508)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
Gene Related Products
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Tau Antisense Oligonucleotide (IONIS-MAPTRx) (Cat#: NV-2106-P29)
- Human superoxide dismutase 1, soluble (SOD1) (NM_000454) ORF clone, TurboGFP Tagged (Cat#: NEP-0521-R0748)
- Human presenilin 1 (PSEN1), transcript variant 2 (NM_007318) ORF clone, TurboGFP Tagged (Cat#: NEP-0421-R0140)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
Biospecimens
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
Cell Assay Reagents
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-IDUA BBB Shuttle Protein (Cat#: NRZP-0423-ZP502)
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP510)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
