Creative Biolabs

Lenti of Mouse interleukin 1 beta (Il1b) (NM_008361) ORF clone, Myc-DDK Tagged

[CAT#: NEP-0521-R0157]

Mouse Interleukin 1 beta (NM_008361) ORF clone, Myc-DDK Tagged

Target:
Il-1β
Gene/Insert name:
IL1B
Type:
Expression Vector/ Viral Particle

Datasheet MSDS Request COA

Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number

Bulk Quote
Description
This is a mouse IL1B Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
IL1B
Species
Mouse
Insert Size (bp)
807 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pLenti-C-Myc-DDK-P2A-Puro
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCAACTGTTCCTGAACTCAACTGTGAAATGCCACCTTTTGACAGTGATGAGAATGACCTGTTCTTTGAAGTTGACGGACCCCAAAAGATGAAGGGCTGCTTCCAAACCTTTGACCTGGGCTGTCCAGATGAGAGCATCCAGCTTCAAATCTCACAGCAGCACATCAACAAGAGCTTCAGGCAGGCAGTATCACTCATTGTGGCTGTGGAGAAGCTGTGGCAGCTACCTGTGTCTTTCCCGTGGACCTTCCAGGATGAGGACATGAGCACCTTCTTTTCCTTCATCTTTGAAGAAGAGCCCATCCTCTGTGACTCATGGGATGATGATGATAACCTGCTGGTGTGTGACGTTCCCATTAGACAGCTGCACTACAGGCTCCGAGATGAACAACAAAAAAGCCTCGTGCTGTCGGACCCATATGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCAACAAGTGATATTCTCCATGAGCTTTGTACAAGGAGAACCAAGCAACGACAAAATACCTGTGGCCTTGGGCCTCAAAGGAAAGAATCTATACCTGTCCTGTGTAATGAAAGACGGCACACCCACCCTGCAGCTGGAGAGTGTGGATCCCAAGCAATACCCAAAGAAGAAGATGGAAAAGCGGTTTGTCTTCAACAAGATAGAAGTCAAGAGCAAAGTGGAGTTTGAGTCTGCAGAGTTCCCCAACTGGTACATCAGCACCTCACAAGCAGAGCACAAGCCTGTCTTCCTGGGAAACAACAGTGGTCAGGACATAATTGACTTCACCATGGAATCTGTGTCTTCCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Metabolism; Neuron
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target
Il-1β
Official Name
IL1B
Full Name
Interleukin 1 beta
Alternative Names
IL1B; IL-1; IL1-BETA; IL1F2; interleukin 1 beta; IL1beta
Gene ID
3552(Human)
Uniprot ID
P01583(Human)
Neural Proteins & Peptides
Neural Genes
Neural Antibodies
For Research Use Only. Not For Clinical Use.
Send Inquiry Send Inquiry
Inquiry Basket
compare

Go to compare