Lenti of Mouse interleukin 1 beta (Il1b) (NM_008361) ORF clone, Myc-DDK Tagged
[CAT#: NEP-0521-R0157]
Mouse Interleukin 1 beta (NM_008361) ORF clone, Myc-DDK Tagged
- Target:
- Il-1β
- Gene/Insert name:
- IL1B
- Type:
- Expression Vector/ Viral Particle
Certificate of Analysis Lookup
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
To download a Certificate of Analysis, please enter a lot number in the search box below. Note: Certificate of Analysis not available for kit components.
Lot Number
Product Overview
Description
This is a mouse IL1B Myc-DDK tagged ORF clone expression plasmid, ready for transfecting into mammalian cells.
Gene/Insert Name
IL1B
Species
Mouse
Insert Size (bp)
807 bp
Tag
Myc-DDK
Type
Expression Vector/ Viral Particle
Vector
pLenti
E. coli Selection
Chloramphenicol (34 ug/mL)
Cell Selection
Puromycin
ORF Nucleotide Sequence
TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCATGGCAACTGTTCCTGAACTCAACTGTGAAATGCCACCTTTTGACAGTGATGAGAATGACCTGTTCTTTGAAGTTGACGGACCCCAAAAGATGAAGGGCTGCTTCCAAACCTTTGACCTGGGCTGTCCAGATGAGAGCATCCAGCTTCAAATCTCACAGCAGCACATCAACAAGAGCTTCAGGCAGGCAGTATCACTCATTGTGGCTGTGGAGAAGCTGTGGCAGCTACCTGTGTCTTTCCCGTGGACCTTCCAGGATGAGGACATGAGCACCTTCTTTTCCTTCATCTTTGAAGAAGAGCCCATCCTCTGTGACTCATGGGATGATGATGATAACCTGCTGGTGTGTGACGTTCCCATTAGACAGCTGCACTACAGGCTCCGAGATGAACAACAAAAAAGCCTCGTGCTGTCGGACCCATATGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCAACAAGTGATATTCTCCATGAGCTTTGTACAAGGAGAACCAAGCAACGACAAAATACCTGTGGCCTTGGGCCTCAAAGGAAAGAATCTATACCTGTCCTGTGTAATGAAAGACGGCACACCCACCCTGCAGCTGGAGAGTGTGGATCCCAAGCAATACCCAAAGAAGAAGATGGAAAAGCGGTTTGTCTTCAACAAGATAGAAGTCAAGAGCAAAGTGGAGTTTGAGTCTGCAGAGTTCCCCAACTGGTACATCAGCACCTCACAAGCAGAGCACAAGCCTGTCTTCCTGGGAAACAACAGTGGTCAGGACATAATTGACTTCACCATGGAATCTGTGTCTTCCACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites
SgfI-MluI
Application Notes
The clone can express a complete ORF with a certain tag. Different ways of expression depend on the specific nature of the gene.
Purification
Ion-exchange column purified
Research Areas
Metabolism; Neuron
Relevant Diseases
Alzheimer's Disease
Key Components
Transfection-ready dried plasmid DNA
Properties
Soluble In
Sterile water
Appearance
Solid
Shipping
Keep in suitable, closed containers for shipping.
Handling Advice
Avoid breathing vapors, mist or gas.
Storage
Store the suspended plasmid at-20°C. The DNA is stable for at least one year from date of shipping when stored at-20°C
Research Use Only
For research use only
Target Details
Publications
Publications (0)
Neural Antibodies
Neural Genes
For Research Use Only. Not For Clinical Use.
Product
Hot Products
Antibodies
- NeuroMab™ Mouse Anti-EFNB2 Monoclonal Antibody (CBP1159) (Cat#: NAB-0720-Z4396)
- NeuroMab™ Mouse Anti-SHANK3 Monoclonal Antibody (CBP929) (Cat#: NAB-0720-Z3477)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2293) (Cat#: NRP-0422-P2293)
- NeuroMab™ Anti-F-Spondin/SPON1 Antibody, Clone N24875P (CBP11839) (Cat#: NRZP-0822-ZP4740)
- NeuroMab™ Anti-TNFα BBB Shuttle Antibody(NRZP-1022-ZP4105) (Cat#: NRZP-1022-ZP4105)
- Mouse Anti-Human α-Synuclein Phospho (Tyr39) (CBP3706) (Cat#: NAB201250LS)
- NeuroMab™ Anti-Tau Antibody(NRP-0422-P2275) (Cat#: NRP-0422-P2275)
- Mouse Anti-SCN5A Monoclonal Antibody (CBP708) (Cat#: NAB-0720-Z2720)
- NeuroMab™ Anti-GARP Antibody(NRP-0422-P1639) (Cat#: NRP-0422-P1639)
- NeuroMab™ Anti-Amyloid Beta 1-15 Antibody(NRP-0422-P867) (Cat#: NRP-0422-P867)
Cells
- Human Hippocampal Neuron Cells HPPNCs (Cat#: NCL2110P106)
- Rat Olfactory Ensheathing Cells (Cat#: NRZP-1122-ZP162)
- Human Astrocytes (Cat#: NCC20-9PZ01)
- Human Brain Microvascular Endothelial Cells (Cat#: NCL-2103-P133)
- Green Fluorescent BACE1 Cell Lines (Cat#: NCL2110P214)
- C57 Brain Cortex Neurons [Mouse] (Cat#: NCC20-9PZ48)
- iNeu™ Human Midbrain Dopaminergic Neurons (Cat#: NCL-21P6-003)
- iNeu™ Retinal Pigment Epithelial Cells (RPE) (Cat#: NRZP-0323-ZP92)
- Mouse Retinal Ganglion Cell Line RGC-5 (Cat#: NCL2110P154)
- Human Brain Vascular Adventitial Fibroblasts (Cat#: NCL-21P6-014)
Kits
- Human GFAP ELISA Kit [Colorimetric] (Cat#: NPP2011ZP383)
- Alpha-Synuclein Aggregation Assay Kit (Cat#: NRZP-1122-ZP37)
- Alpha Synuclein Aggregation Kit (Cat#: NRZP-1122-ZP15)
- Beta Amyloid (1-40), Aggregation Kit (Cat#: NRZP-0323-ZP199)
- Beta Amyloid (1-42), Aggregation Kit (Cat#: NRZP-0323-ZP200)
- Human Tau Aggregation Kit (Cat#: NRP-0322-P2173)
- Amyloid beta 1-42 Kit (Cat#: NRP-0322-P2170)
- Human Poly ADP ribose polymerase,PARP Assay Kit (Cat#: NRZP-1122-ZP62)
Tracers
- AAV2/2Retro-CAG-DIO-EGFP-2A-TetTox-pA [Neural Tracing] (Cat#: NTA-2012-ZP303)
- pAAV-syn-FLEX-jGCaMP8f-WPRE (Cat#: NTA-2106-P064)
- pAAV-syn-jGCaMP8s-WPRE (Cat#: NTA-2106-P063)
- PRV-CAG-EGFP (Cat#: NTA-2011-ZP14)
- pAAV-syn-jGCaMP8f-WPRE (Cat#: NTA-2106-P061)
- Dextran-CYanine5.5 (Cat#: NTA-2011-ZP118)
- AAV2/9-hEF1a-DIO-mCherry-P2A-TetTox-WPRE-pA (Cat#: NTA-2012-ZP268)
- rAAV-E-SARE-Cre-ERT2-PEST-WPRE-hGH polyA (Cat#: NTA-2010-TT342)
- rAAV-CAG-DIO-G-Flamp1 (Cat#: NRZP-0722-ZP719)
- AAV-mDLX-CRE-tdTomato (Cat#: NRZP-0622-ZP721)
Gene Related Products
- Mouse SOD1 shRNA Silencing Adenovirus (Cat#: NV-2106-P14)
- Mouse Parkinson disease (autosomal recessive, early onset) 7 (Park7) (NM_020569) clone, Untagged (Cat#: NEP-0621-R0133)
- Human huntingtin-associated protein 1 (HAP1) transcript variant 2 (NM_177977) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0676)
- Lenti of Human TAR DNA binding protein (TARDBP) (NM_007375) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0832)
- App Rat amyloid beta (A4) precursor protein (App)(NM_019288) ORF clone, Untagged (Cat#: NEP-0421-R0053)
- Rat Parkinson disease (autosomal recessive, juvenile) 2, parkin (Park2) (NM_020093) ORF clone/lentiviral particle, Myc-DDK Tagged (Cat#: NEP-0621-R0041)
- Human apolipoprotein E (APOE) (NM_000041) ORF clone, Untagged (Cat#: NEP-0421-R0232)
- Human huntingtin (HTT) (NM_002111) ORF clone, Myc-DDK Tagged (Cat#: NEP-0521-R0497)
- Human superoxide dismutase 3, extracellular (SOD3) (NM_003102) ORF clone, Untagged (Cat#: NEP-0521-R0808)
- Lenti of Mouse synuclein, alpha (Snca) transcript variant (NM_001042451) ORF clone, mGFP Tagged (Cat#: NEP-0521-R0864)
Biospecimens
- NeuroBiologics™ Mouse Cerebrospinal Fluid (Cat#: NRZP-0822-ZP497)
- NeuroBiologics™ Monkey Cerebrospinal Fluid (Cat#: NRZP-0822-ZP495)
- NeuroBiologics™ Human Cerebrospinal Fluid (Cat#: NRZP-0822-ZP491)
- NeuroBiologics™ Rat Cerebrospinal Fluid (Cat#: NRZP-0822-ZP496)
- NeuroBiologics™ Pig Cerebrospinal Fluid (Cat#: NRZP-0822-ZP498)
Cell Assay Reagents
- NeuroPro™ Anti-idursulfase BBB Shuttle Protein (Cat#: NRZP-0423-ZP497)
- NeuroPro™ Anti-NAGLU BBB Shuttle Protein (Cat#: NRZP-0423-ZP506)
- NeuroPro™ Anti-TNFR BBB Shuttle Protein (Cat#: NRZP-0423-ZP501)
- NeuroPro™ Anti-SGSH BBB Shuttle Protein (Cat#: NRZP-0423-ZP505)
- NeuroPro™ Anti-PON1 BBB Shuttle Protein (Cat#: NRZP-0423-ZP507)
- NeuroPro™ Anti-EPO BBB Shuttle Protein (Cat#: NRZP-0423-ZP508)
- NeuroPro™ Anti-IDS BBB Shuttle Protein (Cat#: NRZP-0423-ZP503)
- NeuroPro™ Anti-Erythropoietin BBB Shuttle Protein (Cat#: NRZP-0423-ZP499)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP509)
- NeuroPro™ Anti-GDNF BBB Shuttle Protein (Cat#: NRZP-0423-ZP500)
